Incidental Mutation 'R4483:Ctsq'
ID331504
Institutional Source Beutler Lab
Gene Symbol Ctsq
Ensembl Gene ENSMUSG00000021439
Gene Namecathepsin Q
Synonyms1600010J02Rik
MMRRC Submission 041739-MU
Accession Numbers

Ncbi RefSeq: NM_029636.3; MGI:2137385

Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R4483 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location61035024-61040631 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61038912 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 93 (I93V)
Ref Sequence ENSEMBL: ENSMUSP00000021888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021888]
Predicted Effect probably benign
Transcript: ENSMUST00000021888
AA Change: I93V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000021888
Gene: ENSMUSG00000021439
AA Change: I93V

DomainStartEndE-ValueType
Inhibitor_I29 29 88 3.76e-24 SMART
Pept_C1 125 342 3.46e-103 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144401
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (36/37)
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 C T 13: 81,419,230 G5275S probably benign Het
Akap11 A G 14: 78,510,259 S1563P probably damaging Het
Ankrd50 A G 3: 38,457,531 V229A probably damaging Het
AW112010 A G 19: 11,050,393 noncoding transcript Het
Ccdc158 A G 5: 92,633,328 S873P probably benign Het
Cep350 A G 1: 155,926,468 V1104A probably benign Het
Chil4 G A 3: 106,214,362 A57V probably damaging Het
Cpa5 A G 6: 30,624,626 E155G probably damaging Het
Dbi A T 1: 120,120,805 I37K probably benign Het
Defa35 T C 8: 21,065,192 S43P probably damaging Het
Fance T A 17: 28,315,807 probably benign Het
Fbxl6 A G 15: 76,537,929 L180P probably damaging Het
Fkbpl T C 17: 34,646,295 F346L probably damaging Het
Gm11735 C A 11: 116,741,275 noncoding transcript Het
Gm28042 T C 2: 120,035,840 I373T possibly damaging Het
Golga4 T C 9: 118,514,186 S27P probably damaging Het
Gstm1 C T 3: 108,016,518 probably null Het
Lama3 T A 18: 12,549,253 I1092K probably benign Het
Med15 A T 16: 17,671,564 probably benign Het
Nlrp6 A G 7: 140,921,781 D87G probably damaging Het
Parp11 A G 6: 127,471,605 T62A probably benign Het
Pcnt A G 10: 76,401,483 L1323S probably damaging Het
Ppp2r1a C T 17: 20,955,810 T98I probably benign Het
Pramef6 T A 4: 143,895,840 Y315F probably damaging Het
Prl7a2 T A 13: 27,660,947 H152L possibly damaging Het
Rnf145 T C 11: 44,564,277 S662P probably benign Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Tnfaip3 A T 10: 19,011,627 M50K probably damaging Het
Txlnb T TTA 10: 17,838,997 probably null Het
Usp9x A G X: 13,121,448 D638G possibly damaging Het
Vmn1r30 A T 6: 58,435,133 V238E probably damaging Het
Zfp507 A G 7: 35,787,716 probably null Het
Zfp532 G T 18: 65,656,565 W1025L probably benign Het
Other mutations in Ctsq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Ctsq APN 13 61037714 missense probably damaging 0.96
IGL00585:Ctsq APN 13 61037127 missense probably benign 0.00
IGL00743:Ctsq APN 13 61036184 missense probably damaging 1.00
IGL00897:Ctsq APN 13 61037725 missense probably damaging 1.00
IGL01679:Ctsq APN 13 61038908 missense probably benign 0.00
IGL01982:Ctsq APN 13 61038918 missense probably benign
IGL01982:Ctsq APN 13 61039521 missense probably benign 0.05
IGL02448:Ctsq APN 13 61036230 missense probably damaging 1.00
R0036:Ctsq UTSW 13 61037671 critical splice donor site probably null
R0036:Ctsq UTSW 13 61037671 critical splice donor site probably null
R0741:Ctsq UTSW 13 61036205 missense probably damaging 0.99
R1192:Ctsq UTSW 13 61039045 missense probably damaging 1.00
R1593:Ctsq UTSW 13 61036172 splice site probably null
R3906:Ctsq UTSW 13 61038771 missense probably damaging 1.00
R4590:Ctsq UTSW 13 61036214 missense probably benign 0.17
R5157:Ctsq UTSW 13 61037099 missense probably benign 0.00
R5365:Ctsq UTSW 13 61037818 missense possibly damaging 0.95
R5366:Ctsq UTSW 13 61037099 missense probably benign 0.00
R5546:Ctsq UTSW 13 61037888 nonsense probably null
R5595:Ctsq UTSW 13 61037060 missense probably benign 0.41
R6046:Ctsq UTSW 13 61039141 missense probably benign 0.00
R6049:Ctsq UTSW 13 61038758 critical splice donor site probably null
R6535:Ctsq UTSW 13 61035326 missense probably damaging 1.00
R6537:Ctsq UTSW 13 61035326 missense probably damaging 1.00
R7159:Ctsq UTSW 13 61038923 missense probably benign 0.00
R8189:Ctsq UTSW 13 61037155 missense probably damaging 1.00
Z1176:Ctsq UTSW 13 61037123 missense probably benign 0.01
Z1177:Ctsq UTSW 13 61037096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATGTGACACTATCATACCTG -3'
(R):5'- ACACGATGTCCAGAGTCTCC -3'

Sequencing Primer
(F):5'- TGATTCCTCACACGAGTCACATAG -3'
(R):5'- GATGTCCAGAGTCTCCTTTCCTCAG -3'
Posted On2015-07-21