Incidental Mutation 'R4483:Fbxl6'
ID 331507
Institutional Source Beutler Lab
Gene Symbol Fbxl6
Ensembl Gene ENSMUSG00000022559
Gene Name F-box and leucine-rich repeat protein 6
Synonyms
MMRRC Submission 041739-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock # R4483 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 76535721-76538746 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 76537929 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 180 (L180P)
Ref Sequence ENSEMBL: ENSMUSP00000023219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023219] [ENSMUST00000023220] [ENSMUST00000230604]
AlphaFold Q9QXW0
Predicted Effect probably damaging
Transcript: ENSMUST00000023219
AA Change: L180P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023219
Gene: ENSMUSG00000022559
AA Change: L180P

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 58 77 N/A INTRINSIC
Pfam:F-box 104 154 3.1e-6 PFAM
Pfam:F-box-like 105 155 1.8e-13 PFAM
low complexity region 163 174 N/A INTRINSIC
SCOP:d1yrga_ 184 448 3e-9 SMART
Blast:LRR 211 236 2e-6 BLAST
Blast:LRR 347 373 6e-8 BLAST
Blast:LRR 375 405 7e-9 BLAST
Blast:LRR 432 456 7e-6 BLAST
Blast:LRR 464 488 1e-5 BLAST
Blast:LRR 489 520 7e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000023220
SMART Domains Protein: ENSMUSP00000023220
Gene: ENSMUSG00000022560

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
transmembrane domain 46 68 N/A INTRINSIC
transmembrane domain 81 103 N/A INTRINSIC
transmembrane domain 113 135 N/A INTRINSIC
transmembrane domain 142 164 N/A INTRINSIC
transmembrane domain 201 223 N/A INTRINSIC
Pfam:DUF1011 278 376 3e-38 PFAM
transmembrane domain 409 431 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228994
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229074
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229813
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230513
Predicted Effect probably benign
Transcript: ENSMUST00000230604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230994
Meta Mutation Damage Score 0.7729 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that are characterized by an F-box motif. The encoded protein also contains leucine-rich repeats. F-box-containing proteins comprise one of the subunits of the SCF (SKP1-cullin-F-box) complex, which functions in phosphorylation-dependent ubiquitination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 C T 13: 81,419,230 G5275S probably benign Het
Akap11 A G 14: 78,510,259 S1563P probably damaging Het
Ankrd50 A G 3: 38,457,531 V229A probably damaging Het
AW112010 A G 19: 11,050,393 noncoding transcript Het
Ccdc158 A G 5: 92,633,328 S873P probably benign Het
Cep350 A G 1: 155,926,468 V1104A probably benign Het
Chil4 G A 3: 106,214,362 A57V probably damaging Het
Cpa5 A G 6: 30,624,626 E155G probably damaging Het
Ctsq T C 13: 61,038,912 I93V probably benign Het
Dbi A T 1: 120,120,805 I37K probably benign Het
Defa35 T C 8: 21,065,192 S43P probably damaging Het
Fance T A 17: 28,315,807 probably benign Het
Fkbpl T C 17: 34,646,295 F346L probably damaging Het
Gm11735 C A 11: 116,741,275 noncoding transcript Het
Gm28042 T C 2: 120,035,840 I373T possibly damaging Het
Golga4 T C 9: 118,514,186 S27P probably damaging Het
Gstm1 C T 3: 108,016,518 probably null Het
Lama3 T A 18: 12,549,253 I1092K probably benign Het
Med15 A T 16: 17,671,564 probably benign Het
Nlrp6 A G 7: 140,921,781 D87G probably damaging Het
Parp11 A G 6: 127,471,605 T62A probably benign Het
Pcnt A G 10: 76,401,483 L1323S probably damaging Het
Ppp2r1a C T 17: 20,955,810 T98I probably benign Het
Pramef6 T A 4: 143,895,840 Y315F probably damaging Het
Prl7a2 T A 13: 27,660,947 H152L possibly damaging Het
Rnf145 T C 11: 44,564,277 S662P probably benign Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Tnfaip3 A T 10: 19,011,627 M50K probably damaging Het
Txlnb T TTA 10: 17,838,997 probably null Het
Usp9x A G X: 13,121,448 D638G possibly damaging Het
Vmn1r30 A T 6: 58,435,133 V238E probably damaging Het
Zfp507 A G 7: 35,787,716 probably null Het
Zfp532 G T 18: 65,656,565 W1025L probably benign Het
Other mutations in Fbxl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02088:Fbxl6 APN 15 76535906 nonsense probably null
IGL02205:Fbxl6 APN 15 76537341 missense probably benign 0.05
R0244:Fbxl6 UTSW 15 76537191 missense probably damaging 1.00
R0449:Fbxl6 UTSW 15 76535955 missense probably damaging 1.00
R0608:Fbxl6 UTSW 15 76536753 missense probably benign 0.04
R0904:Fbxl6 UTSW 15 76537083 splice site probably null
R1477:Fbxl6 UTSW 15 76537734 missense probably benign
R1784:Fbxl6 UTSW 15 76538058 missense probably damaging 1.00
R2109:Fbxl6 UTSW 15 76536973 missense probably damaging 0.99
R3937:Fbxl6 UTSW 15 76536624 nonsense probably null
R4414:Fbxl6 UTSW 15 76537724 missense possibly damaging 0.76
R4416:Fbxl6 UTSW 15 76537724 missense possibly damaging 0.76
R4835:Fbxl6 UTSW 15 76536804 missense probably damaging 1.00
R6175:Fbxl6 UTSW 15 76538433 missense probably benign
R6345:Fbxl6 UTSW 15 76535854 missense probably damaging 1.00
R6750:Fbxl6 UTSW 15 76538412 missense probably damaging 1.00
R6800:Fbxl6 UTSW 15 76538698 unclassified probably benign
R7485:Fbxl6 UTSW 15 76537913 splice site probably null
R7560:Fbxl6 UTSW 15 76538469 missense probably benign 0.06
R7726:Fbxl6 UTSW 15 76535886 missense probably damaging 1.00
R7811:Fbxl6 UTSW 15 76537285 splice site probably null
R8353:Fbxl6 UTSW 15 76538478 missense probably benign 0.06
R8548:Fbxl6 UTSW 15 76537342 missense possibly damaging 0.65
X0058:Fbxl6 UTSW 15 76538476 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- AGTGGATGAGGGTCAAGCTC -3'
(R):5'- TGCGCTGCTCCTAAAACAC -3'

Sequencing Primer
(F):5'- CTCTGGAGCTGAGAGAACCTG -3'
(R):5'- TTGTAGGCATTACCCGCAAAAG -3'
Posted On 2015-07-21