Mutagenetix > Incidental Mutations

Incidental Mutation 'R4483:Fbxl6'

331507

Institutional Source

Beutler Lab

Gene Symbol

Fbxl6

Ensembl Gene

ENSMUSG00000022559

Gene Name

F-box and leucine-rich repeat protein 6

Synonyms

MMRRC Submission

041739-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.148) question?

Stock #

R4483 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

76535721-76538746 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 76537929 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 180 (L180P)

Ref Sequence

ENSEMBL: ENSMUSP00000023219 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023219] [ENSMUST00000023220] [ENSMUST00000230604]

AlphaFold

Q9QXW0

Predicted Effect

probably damaging
Transcript: ENSMUST00000023219
AA Change: L180P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000023219
Gene: ENSMUSG00000022559
AA Change: L180P

Domain	Start	End	E-Value	Type
low complexity region	2	22	N/A	INTRINSIC
low complexity region	58	77	N/A	INTRINSIC
Pfam:F-box	104	154	3.1e-6	PFAM
Pfam:F-box-like	105	155	1.8e-13	PFAM
low complexity region	163	174	N/A	INTRINSIC
SCOP:d1yrga_	184	448	3e-9	SMART
Blast:LRR	211	236	2e-6	BLAST
Blast:LRR	347	373	6e-8	BLAST
Blast:LRR	375	405	7e-9	BLAST
Blast:LRR	432	456	7e-6	BLAST
Blast:LRR	464	488	1e-5	BLAST
Blast:LRR	489	520	7e-13	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000023220

SMART Domains

Protein: ENSMUSP00000023220
Gene: ENSMUSG00000022560

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	32	43	N/A	INTRINSIC
transmembrane domain	46	68	N/A	INTRINSIC
transmembrane domain	81	103	N/A	INTRINSIC
transmembrane domain	113	135	N/A	INTRINSIC
transmembrane domain	142	164	N/A	INTRINSIC
transmembrane domain	201	223	N/A	INTRINSIC
Pfam:DUF1011	278	376	3e-38	PFAM
transmembrane domain	409	431	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228994

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229074

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229273

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229813

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230513

Predicted Effect

probably benign
Transcript: ENSMUST00000230604

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230938

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230994

Meta Mutation Damage Score

0.7729

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that are characterized by an F-box motif. The encoded protein also contains leucine-rich repeats. F-box-containing proteins comprise one of the subunits of the SCF (SKP1-cullin-F-box) complex, which functions in phosphorylation-dependent ubiquitination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	C	T	13: 81,419,230	G5275S	probably benign	Het
Akap11	A	G	14: 78,510,259	S1563P	probably damaging	Het
Ankrd50	A	G	3: 38,457,531	V229A	probably damaging	Het
AW112010	A	G	19: 11,050,393		noncoding transcript	Het
Ccdc158	A	G	5: 92,633,328	S873P	probably benign	Het
Cep350	A	G	1: 155,926,468	V1104A	probably benign	Het
Chil4	G	A	3: 106,214,362	A57V	probably damaging	Het
Cpa5	A	G	6: 30,624,626	E155G	probably damaging	Het
Ctsq	T	C	13: 61,038,912	I93V	probably benign	Het
Dbi	A	T	1: 120,120,805	I37K	probably benign	Het
Defa35	T	C	8: 21,065,192	S43P	probably damaging	Het
Fance	T	A	17: 28,315,807		probably benign	Het
Fkbpl	T	C	17: 34,646,295	F346L	probably damaging	Het
Gm11735	C	A	11: 116,741,275		noncoding transcript	Het
Gm28042	T	C	2: 120,035,840	I373T	possibly damaging	Het
Golga4	T	C	9: 118,514,186	S27P	probably damaging	Het
Gstm1	C	T	3: 108,016,518		probably null	Het
Lama3	T	A	18: 12,549,253	I1092K	probably benign	Het
Med15	A	T	16: 17,671,564		probably benign	Het
Nlrp6	A	G	7: 140,921,781	D87G	probably damaging	Het
Parp11	A	G	6: 127,471,605	T62A	probably benign	Het
Pcnt	A	G	10: 76,401,483	L1323S	probably damaging	Het
Ppp2r1a	C	T	17: 20,955,810	T98I	probably benign	Het
Pramef6	T	A	4: 143,895,840	Y315F	probably damaging	Het
Prl7a2	T	A	13: 27,660,947	H152L	possibly damaging	Het
Rnf145	T	C	11: 44,564,277	S662P	probably benign	Het
Rpl31-ps17	C	T	12: 54,701,612		noncoding transcript	Het
Tnfaip3	A	T	10: 19,011,627	M50K	probably damaging	Het
Txlnb	T	TTA	10: 17,838,997		probably null	Het
Usp9x	A	G	X: 13,121,448	D638G	possibly damaging	Het
Vmn1r30	A	T	6: 58,435,133	V238E	probably damaging	Het
Zfp507	A	G	7: 35,787,716		probably null	Het
Zfp532	G	T	18: 65,656,565	W1025L	probably benign	Het

Other mutations in Fbxl6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02088:Fbxl6	APN	15	76535906	nonsense	probably null
IGL02205:Fbxl6	APN	15	76537341	missense	probably benign	0.05
R0244:Fbxl6	UTSW	15	76537191	missense	probably damaging	1.00
R0449:Fbxl6	UTSW	15	76535955	missense	probably damaging	1.00
R0608:Fbxl6	UTSW	15	76536753	missense	probably benign	0.04
R0904:Fbxl6	UTSW	15	76537083	splice site	probably null
R1477:Fbxl6	UTSW	15	76537734	missense	probably benign
R1784:Fbxl6	UTSW	15	76538058	missense	probably damaging	1.00
R2109:Fbxl6	UTSW	15	76536973	missense	probably damaging	0.99
R3937:Fbxl6	UTSW	15	76536624	nonsense	probably null
R4414:Fbxl6	UTSW	15	76537724	missense	possibly damaging	0.76
R4416:Fbxl6	UTSW	15	76537724	missense	possibly damaging	0.76
R4835:Fbxl6	UTSW	15	76536804	missense	probably damaging	1.00
R6175:Fbxl6	UTSW	15	76538433	missense	probably benign
R6345:Fbxl6	UTSW	15	76535854	missense	probably damaging	1.00
R6750:Fbxl6	UTSW	15	76538412	missense	probably damaging	1.00
R6800:Fbxl6	UTSW	15	76538698	unclassified	probably benign
R7485:Fbxl6	UTSW	15	76537913	splice site	probably null
R7560:Fbxl6	UTSW	15	76538469	missense	probably benign	0.06
R7726:Fbxl6	UTSW	15	76535886	missense	probably damaging	1.00
R7811:Fbxl6	UTSW	15	76537285	splice site	probably null
R8353:Fbxl6	UTSW	15	76538478	missense	probably benign	0.06
R8548:Fbxl6	UTSW	15	76537342	missense	possibly damaging	0.65
X0058:Fbxl6	UTSW	15	76538476	missense	possibly damaging	0.71

Predicted Primers

PCR Primer
(F):5'- AGTGGATGAGGGTCAAGCTC -3'
(R):5'- TGCGCTGCTCCTAAAACAC -3'

Sequencing Primer
(F):5'- CTCTGGAGCTGAGAGAACCTG -3'
(R):5'- TTGTAGGCATTACCCGCAAAAG -3'

Posted On

2015-07-21