Mutagenetix > Incidental Mutation

Incidental Mutation 'R4483:Ppp2r1a'

331509

Institutional Source

Beutler Lab

Gene Symbol

Ppp2r1a

Ensembl Gene

ENSMUSG00000007564

Gene Name

protein phosphatase 2, regulatory subunit A, alpha

Synonyms

PR65, PP2A, 6330556D22Rik, protein phosphatase PP2A

MMRRC Submission

041739-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4483 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20945311-20965916 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 20955810 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 98 (T98I)

Ref Sequence

ENSEMBL: ENSMUSP00000007708 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000007708] [ENSMUST00000147983] [ENSMUST00000173658]

AlphaFold

Q76MZ3

PDB Structure

Crystal structure of a protein phosphatase 2A (PP2A) holoenzyme. [X-RAY DIFFRACTION]
Crystal structure of the full-length simian virus 40 small t antigen complexed with the protein phosphatase 2A Aalpha subunit [X-RAY DIFFRACTION]
Structural Basis of PP2A and Sgo interaction [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000007708
AA Change: T98I

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000007708
Gene: ENSMUSG00000007564
AA Change: T98I

Domain	Start	End	E-Value	Type
Pfam:HEAT	166	196	4.3e-6	PFAM
Pfam:HEAT_2	170	266	1.7e-8	PFAM
Pfam:HEAT	283	313	3.4e-5	PFAM
Pfam:HEAT_2	366	467	5.3e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136975

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138971

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139293

Predicted Effect

probably benign
Transcript: ENSMUST00000147983

SMART Domains

Protein: ENSMUSP00000133334
Gene: ENSMUSG00000007564

Domain	Start	End	E-Value	Type
Pfam:HEAT	13	43	2.1e-5	PFAM
Pfam:HEAT	52	82	2.9e-5	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173359

Predicted Effect

probably benign
Transcript: ENSMUST00000173658

SMART Domains

Protein: ENSMUSP00000133778
Gene: ENSMUSG00000007564

Domain	Start	End	E-Value	Type
PDB:2PF4\|D	1	72	3e-40	PDB
SCOP:d1b3ua_	2	86	3e-12	SMART

Meta Mutation Damage Score

0.1231

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a constant regulatory subunit of protein phosphatase 2. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The constant regulatory subunit A serves as a scaffolding molecule to coordinate the assembly of the catalytic subunit and a variable regulatory B subunit. This gene encodes an alpha isoform of the constant regulatory subunit A. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a targeted allele that remove exons 5 and 6 exhibit embryonic lethality. Mice heterozygous for this allele exhibit increased benzopyrene-induced lung tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	C	T	13: 81,419,230	G5275S	probably benign	Het
Akap11	A	G	14: 78,510,259	S1563P	probably damaging	Het
Ankrd50	A	G	3: 38,457,531	V229A	probably damaging	Het
AW112010	A	G	19: 11,050,393		noncoding transcript	Het
Ccdc158	A	G	5: 92,633,328	S873P	probably benign	Het
Cep350	A	G	1: 155,926,468	V1104A	probably benign	Het
Chil4	G	A	3: 106,214,362	A57V	probably damaging	Het
Cpa5	A	G	6: 30,624,626	E155G	probably damaging	Het
Ctsq	T	C	13: 61,038,912	I93V	probably benign	Het
Dbi	A	T	1: 120,120,805	I37K	probably benign	Het
Defa35	T	C	8: 21,065,192	S43P	probably damaging	Het
Fance	T	A	17: 28,315,807		probably benign	Het
Fbxl6	A	G	15: 76,537,929	L180P	probably damaging	Het
Fkbpl	T	C	17: 34,646,295	F346L	probably damaging	Het
Gm11735	C	A	11: 116,741,275		noncoding transcript	Het
Gm28042	T	C	2: 120,035,840	I373T	possibly damaging	Het
Golga4	T	C	9: 118,514,186	S27P	probably damaging	Het
Gstm1	C	T	3: 108,016,518		probably null	Het
Lama3	T	A	18: 12,549,253	I1092K	probably benign	Het
Med15	A	T	16: 17,671,564		probably benign	Het
Nlrp6	A	G	7: 140,921,781	D87G	probably damaging	Het
Parp11	A	G	6: 127,471,605	T62A	probably benign	Het
Pcnt	A	G	10: 76,401,483	L1323S	probably damaging	Het
Pramef6	T	A	4: 143,895,840	Y315F	probably damaging	Het
Prl7a2	T	A	13: 27,660,947	H152L	possibly damaging	Het
Rnf145	T	C	11: 44,564,277	S662P	probably benign	Het
Rpl31-ps17	C	T	12: 54,701,612		noncoding transcript	Het
Tnfaip3	A	T	10: 19,011,627	M50K	probably damaging	Het
Txlnb	T	TTA	10: 17,838,997		probably null	Het
Usp9x	A	G	X: 13,121,448	D638G	possibly damaging	Het
Vmn1r30	A	T	6: 58,435,133	V238E	probably damaging	Het
Zfp507	A	G	7: 35,787,716		probably null	Het
Zfp532	G	T	18: 65,656,565	W1025L	probably benign	Het

Other mutations in Ppp2r1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00959:Ppp2r1a	APN	17	20961578	unclassified	probably benign
IGL01815:Ppp2r1a	APN	17	20956832	missense	probably benign	0.00
IGL01923:Ppp2r1a	APN	17	20965469	makesense	probably null
IGL02411:Ppp2r1a	APN	17	20951334	splice site	probably benign
IGL02694:Ppp2r1a	APN	17	20951440	splice site	probably benign
IGL02742:Ppp2r1a	APN	17	20959003	missense	probably benign	0.01
Altricial	UTSW	17	20954717	critical splice donor site	probably null
Dolmas	UTSW	17	20960631	nonsense	probably null
R0032:Ppp2r1a	UTSW	17	20945584	critical splice donor site	probably benign
R0403:Ppp2r1a	UTSW	17	20957041	missense	probably damaging	0.96
R1170:Ppp2r1a	UTSW	17	20951331	splice site	probably benign
R1652:Ppp2r1a	UTSW	17	20955974	missense	probably benign	0.03
R1857:Ppp2r1a	UTSW	17	20961689	missense	possibly damaging	0.93
R2215:Ppp2r1a	UTSW	17	20961743	splice site	probably null
R3800:Ppp2r1a	UTSW	17	20962710	missense	possibly damaging	0.82
R4013:Ppp2r1a	UTSW	17	20951347	missense	probably damaging	1.00
R5014:Ppp2r1a	UTSW	17	20958839	splice site	probably null
R5421:Ppp2r1a	UTSW	17	20956706	missense	probably benign
R5615:Ppp2r1a	UTSW	17	20958987	missense	probably benign	0.00
R5945:Ppp2r1a	UTSW	17	20959413	missense	possibly damaging	0.81
R5986:Ppp2r1a	UTSW	17	20951346	missense	probably damaging	1.00
R6466:Ppp2r1a	UTSW	17	20960631	nonsense	probably null
R6727:Ppp2r1a	UTSW	17	20955825	missense	probably benign	0.07
R6738:Ppp2r1a	UTSW	17	20954717	critical splice donor site	probably null
R6934:Ppp2r1a	UTSW	17	20961633	missense	possibly damaging	0.56
R7549:Ppp2r1a	UTSW	17	20962682	missense	possibly damaging	0.95
R7904:Ppp2r1a	UTSW	17	20961741	critical splice donor site	probably null
R7922:Ppp2r1a	UTSW	17	20954617	missense	probably benign
R7998:Ppp2r1a	UTSW	17	20961639	missense	possibly damaging	0.93
R8150:Ppp2r1a	UTSW	17	20959438	missense	possibly damaging	0.75
R8204:Ppp2r1a	UTSW	17	20956773	missense	probably benign	0.20
R9347:Ppp2r1a	UTSW	17	20961615	missense	probably benign	0.18
R9352:Ppp2r1a	UTSW	17	20965237	critical splice acceptor site	probably null
R9528:Ppp2r1a	UTSW	17	20955891	missense	probably benign	0.21
R9712:Ppp2r1a	UTSW	17	20958796	missense	probably damaging	0.99
R9772:Ppp2r1a	UTSW	17	20961593	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGAGAGCTACACACATGGACC -3'
(R):5'- ACTGTCGAAGTTCTGCCTTC -3'

Sequencing Primer
(F):5'- CATGGACCTCCTGAGAGATTC -3'
(R):5'- TTCACGGCACTGGATACTCG -3'

Posted On

2015-07-21