Incidental Mutation 'R4484:Rxrg'
ID331518
Institutional Source Beutler Lab
Gene Symbol Rxrg
Ensembl Gene ENSMUSG00000015843
Gene Nameretinoid X receptor gamma
SynonymsNr2b3
MMRRC Submission 041740-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.807) question?
Stock #R4484 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location167598384-167639623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 167625027 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 133 (S133P)
Ref Sequence ENSEMBL: ENSMUSP00000107017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015987] [ENSMUST00000111380] [ENSMUST00000111384] [ENSMUST00000111386]
Predicted Effect probably benign
Transcript: ENSMUST00000015987
AA Change: S133P

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000015987
Gene: ENSMUSG00000015843
AA Change: S133P

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 25 134 1.2e-39 PFAM
ZnF_C4 136 207 6.92e-39 SMART
HOLI 271 430 2.7e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111380
AA Change: S10P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107011
Gene: ENSMUSG00000015843
AA Change: S10P

DomainStartEndE-ValueType
ZnF_C4 13 84 6.92e-39 SMART
HOLI 148 307 2.7e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111384
AA Change: S133P

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000107015
Gene: ENSMUSG00000015843
AA Change: S133P

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 24 134 3.4e-35 PFAM
ZnF_C4 136 207 6.92e-39 SMART
HOLI 271 430 2.7e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111386
AA Change: S133P

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000107017
Gene: ENSMUSG00000015843
AA Change: S133P

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 24 134 3.4e-35 PFAM
ZnF_C4 136 207 6.92e-39 SMART
HOLI 271 430 2.7e-50 SMART
Meta Mutation Damage Score 0.1267 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the retinoid X receptor (RXR) family of nuclear receptors which are involved in mediating the antiproliferative effects of retinoic acid (RA). This receptor forms dimers with the retinoic acid, thyroid hormone, and vitamin D receptors, increasing both DNA binding and transcriptional function on their respective response elements. This gene is expressed at significantly lower levels in non-small cell lung cancer cells. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jun 2010]
PHENOTYPE: Targeted disruption of exon 2 causes a 25% reduction of neurons in the striatum and may lead to premature death and altered responses to the administration of dopamine antagonists on some genetic backgrounds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox4 T C 1: 58,262,571 C1101R probably damaging Het
Atp8b5 T C 4: 43,357,016 I588T probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
BC067074 A T 13: 113,319,199 N593I probably damaging Het
Cd164l2 T A 4: 133,223,675 V147E probably damaging Het
Celsr3 G A 9: 108,846,063 probably null Het
Cr2 T C 1: 195,154,174 T894A probably damaging Het
Crtc3 T C 7: 80,589,948 D552G probably damaging Het
Cyp2c50 A G 19: 40,090,639 E142G probably damaging Het
Dcstamp A G 15: 39,754,224 I10V probably benign Het
Fam208b T C 13: 3,581,831 D890G probably benign Het
Gm44501 T A 17: 40,576,616 F8L unknown Het
Gpr179 T C 11: 97,335,711 S1873G probably benign Het
Gprin2 C A 14: 34,194,797 A339S probably benign Het
Gucy1b2 T A 14: 62,411,589 I513F possibly damaging Het
Ighv5-6 T A 12: 113,625,588 R91* probably null Het
Igtp G A 11: 58,206,998 V332I possibly damaging Het
Itfg1 G A 8: 85,726,249 P497S probably damaging Het
Junb T C 8: 84,977,888 N181S possibly damaging Het
Lama3 T C 18: 12,481,088 Y1305H probably benign Het
Lrrcc1 A T 3: 14,551,443 N44I probably damaging Het
Med15 A T 16: 17,671,564 probably benign Het
Mkks T C 2: 136,880,574 E221G probably benign Het
Mtmr10 T C 7: 64,320,631 V374A possibly damaging Het
Muc5b G T 7: 141,868,450 C4441F possibly damaging Het
Nim1k G A 13: 119,712,174 Q395* probably null Het
Nlrp6 A G 7: 140,921,781 D87G probably damaging Het
Ntng1 C A 3: 110,143,808 probably benign Het
Padi1 G T 4: 140,817,270 probably benign Het
Snx19 T C 9: 30,427,896 I110T probably benign Het
Strap T C 6: 137,749,336 probably benign Het
Tgtp2 A T 11: 49,059,352 M131K probably damaging Het
Tppp2 T C 14: 51,919,411 F82L probably damaging Het
Ttc39c A G 18: 12,730,069 K397E possibly damaging Het
Txlnb T TTA 10: 17,838,997 probably null Het
Usp36 T A 11: 118,285,795 R66W probably damaging Het
Vmn1r30 A T 6: 58,435,133 V238E probably damaging Het
Vmn1r6 A G 6: 57,003,189 I279V probably benign Het
Vmn2r61 G A 7: 42,300,696 D847N probably benign Het
Zfp622 G A 15: 25,987,051 probably null Het
Zfp963 T C 8: 69,744,485 I36V probably benign Het
Zfy2 A G Y: 2,107,351 Y428H possibly damaging Het
Other mutations in Rxrg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00818:Rxrg APN 1 167627288 splice site probably benign
IGL01767:Rxrg APN 1 167627315 missense probably damaging 1.00
IGL02126:Rxrg APN 1 167634460 missense probably damaging 0.98
IGL03144:Rxrg APN 1 167598758 missense possibly damaging 0.53
R0482:Rxrg UTSW 1 167631037 missense possibly damaging 0.94
R0548:Rxrg UTSW 1 167631219 splice site probably benign
R0734:Rxrg UTSW 1 167627444 missense probably damaging 1.00
R1294:Rxrg UTSW 1 167613901 missense probably benign
R1843:Rxrg UTSW 1 167598752 start codon destroyed probably benign 0.02
R2093:Rxrg UTSW 1 167627324 missense probably damaging 1.00
R2972:Rxrg UTSW 1 167639146 missense probably damaging 1.00
R2974:Rxrg UTSW 1 167639146 missense probably damaging 1.00
R3177:Rxrg UTSW 1 167635700 missense possibly damaging 0.64
R3277:Rxrg UTSW 1 167635700 missense possibly damaging 0.64
R4721:Rxrg UTSW 1 167625052 missense probably damaging 1.00
R5267:Rxrg UTSW 1 167635766 missense probably damaging 0.98
R5323:Rxrg UTSW 1 167625004 missense probably benign
R5858:Rxrg UTSW 1 167627356 missense probably damaging 1.00
R5921:Rxrg UTSW 1 167639239 missense possibly damaging 0.55
R6142:Rxrg UTSW 1 167632622 missense possibly damaging 0.69
R6370:Rxrg UTSW 1 167634437 missense probably damaging 1.00
R6595:Rxrg UTSW 1 167627336 missense probably damaging 1.00
R6702:Rxrg UTSW 1 167613805 missense probably benign
R7133:Rxrg UTSW 1 167631109 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGCTCATCTCACATGCACG -3'
(R):5'- AAGACTGCAGGCTCTGAAC -3'

Sequencing Primer
(F):5'- TCACATGCACGCGCCTTG -3'
(R):5'- GGCTCTGAACCCCGTAATAG -3'
Posted On2015-07-21