Incidental Mutation 'R4484:Mkks'
ID331521
Institutional Source Beutler Lab
Gene Symbol Mkks
Ensembl Gene ENSMUSG00000027274
Gene NameMcKusick-Kaufman syndrome
Synonyms1300013E18Rik, Bbs6
MMRRC Submission 041740-MU
Accession Numbers

Genbank: NM_021527; MGI: 1891836

Is this an essential gene? Possibly non essential (E-score: 0.439) question?
Stock #R4484 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location136873780-136891389 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 136880574 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 221 (E221G)
Ref Sequence ENSEMBL: ENSMUSP00000105716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028730] [ENSMUST00000110089] [ENSMUST00000144275] [ENSMUST00000227806] [ENSMUST00000231720]
Predicted Effect probably benign
Transcript: ENSMUST00000028730
AA Change: E221G

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000028730
Gene: ENSMUSG00000027274
AA Change: E221G

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 29 570 2.5e-109 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110089
AA Change: E221G

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105716
Gene: ENSMUSG00000027274
AA Change: E221G

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 29 570 2.3e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144275
Predicted Effect probably benign
Transcript: ENSMUST00000227806
Predicted Effect probably benign
Transcript: ENSMUST00000231720
Meta Mutation Damage Score 0.3030 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: This gene encodes a protein which shares sequence similarity with other members of the type II chaperonin family. The encoded protein is a centrosome-shuttling protein and plays an important role in cytokinesis. This protein also interacts with other type II chaperonin members to form a complex known as the BBSome, which involves ciliary membrane biogenesis. This protein is encoded by a downstream open reading frame (dORF). Several upstream open reading frames (uORFs) have been identified, which repress the translation of the dORF, and two of which can encode small mitochondrial membrane proteins. Alternatively spliced transcripts encoding distinct isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Homozygous null mice display partial embryonic lethality, retinal degeneration, obesity, increased food intake, hypoactivity, increased blood pressure, male infertility with the absence of flagella on spermatozoa, decreased aggression, and impaired olfaction but, do not display limb deformities. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted, knock-out(1) Gene trapped(10)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox4 T C 1: 58,262,571 C1101R probably damaging Het
Atp8b5 T C 4: 43,357,016 I588T probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
BC067074 A T 13: 113,319,199 N593I probably damaging Het
Cd164l2 T A 4: 133,223,675 V147E probably damaging Het
Celsr3 G A 9: 108,846,063 probably null Het
Cr2 T C 1: 195,154,174 T894A probably damaging Het
Crtc3 T C 7: 80,589,948 D552G probably damaging Het
Cyp2c50 A G 19: 40,090,639 E142G probably damaging Het
Dcstamp A G 15: 39,754,224 I10V probably benign Het
Fam208b T C 13: 3,581,831 D890G probably benign Het
Gm44501 T A 17: 40,576,616 F8L unknown Het
Gpr179 T C 11: 97,335,711 S1873G probably benign Het
Gprin2 C A 14: 34,194,797 A339S probably benign Het
Gucy1b2 T A 14: 62,411,589 I513F possibly damaging Het
Ighv5-6 T A 12: 113,625,588 R91* probably null Het
Igtp G A 11: 58,206,998 V332I possibly damaging Het
Itfg1 G A 8: 85,726,249 P497S probably damaging Het
Junb T C 8: 84,977,888 N181S possibly damaging Het
Lama3 T C 18: 12,481,088 Y1305H probably benign Het
Lrrcc1 A T 3: 14,551,443 N44I probably damaging Het
Med15 A T 16: 17,671,564 probably benign Het
Mtmr10 T C 7: 64,320,631 V374A possibly damaging Het
Muc5b G T 7: 141,868,450 C4441F possibly damaging Het
Nim1k G A 13: 119,712,174 Q395* probably null Het
Nlrp6 A G 7: 140,921,781 D87G probably damaging Het
Ntng1 C A 3: 110,143,808 probably benign Het
Padi1 G T 4: 140,817,270 probably benign Het
Rxrg T C 1: 167,625,027 S133P probably benign Het
Snx19 T C 9: 30,427,896 I110T probably benign Het
Strap T C 6: 137,749,336 probably benign Het
Tgtp2 A T 11: 49,059,352 M131K probably damaging Het
Tppp2 T C 14: 51,919,411 F82L probably damaging Het
Ttc39c A G 18: 12,730,069 K397E possibly damaging Het
Txlnb T TTA 10: 17,838,997 probably null Het
Usp36 T A 11: 118,285,795 R66W probably damaging Het
Vmn1r30 A T 6: 58,435,133 V238E probably damaging Het
Vmn1r6 A G 6: 57,003,189 I279V probably benign Het
Vmn2r61 G A 7: 42,300,696 D847N probably benign Het
Zfp622 G A 15: 25,987,051 probably null Het
Zfp963 T C 8: 69,744,485 I36V probably benign Het
Zfy2 A G Y: 2,107,351 Y428H possibly damaging Het
Other mutations in Mkks
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03058:Mkks APN 2 136876170 missense probably damaging 1.00
D4043:Mkks UTSW 2 136874610 missense probably benign 0.01
R0183:Mkks UTSW 2 136880686 missense probably benign 0.01
R0193:Mkks UTSW 2 136877606 unclassified probably null
R1394:Mkks UTSW 2 136880962 missense probably damaging 1.00
R1765:Mkks UTSW 2 136880367 missense probably damaging 1.00
R4678:Mkks UTSW 2 136880281 missense probably benign 0.00
R4791:Mkks UTSW 2 136876162 missense probably benign 0.03
R4825:Mkks UTSW 2 136880655 missense probably benign 0.05
R4902:Mkks UTSW 2 136876174 missense probably benign 0.39
R5709:Mkks UTSW 2 136880736 missense probably benign 0.04
R6449:Mkks UTSW 2 136874286 missense probably damaging 0.98
R7021:Mkks UTSW 2 136876087 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTGGCACAGGACAAGGTCTAC -3'
(R):5'- AACCAGCCTGTATGCTCACC -3'

Sequencing Primer
(F):5'- GTCTACATGATCAGTGACTAGTCGC -3'
(R):5'- GCCTGTATGCTCACCAGAAAGG -3'
Posted On2015-07-21