Incidental Mutation 'R4484:Atp8b5'
ID331525
Institutional Source Beutler Lab
Gene Symbol Atp8b5
Ensembl Gene ENSMUSG00000028457
Gene NameATPase, class I, type 8B, member 5
Synonyms4930417M19Rik, FetA
MMRRC Submission 041740-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R4484 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43267159-43373833 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43357016 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 588 (I588T)
Ref Sequence ENSEMBL: ENSMUSP00000103575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107937] [ENSMUST00000107942]
Predicted Effect probably benign
Transcript: ENSMUST00000107937
Predicted Effect probably damaging
Transcript: ENSMUST00000107942
AA Change: I588T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103575
Gene: ENSMUSG00000028457
AA Change: I588T

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 104 1.8e-26 PFAM
Pfam:E1-E2_ATPase 103 375 4.9e-9 PFAM
Pfam:HAD 413 847 2e-18 PFAM
Pfam:Cation_ATPase 495 594 1e-9 PFAM
Pfam:PhoLip_ATPase_C 864 1118 2.6e-77 PFAM
low complexity region 1171 1180 N/A INTRINSIC
Meta Mutation Damage Score 0.094 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox4 T C 1: 58,262,571 C1101R probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
BC067074 A T 13: 113,319,199 N593I probably damaging Het
Cd164l2 T A 4: 133,223,675 V147E probably damaging Het
Celsr3 G A 9: 108,846,063 probably null Het
Cr2 T C 1: 195,154,174 T894A probably damaging Het
Crtc3 T C 7: 80,589,948 D552G probably damaging Het
Cyp2c50 A G 19: 40,090,639 E142G probably damaging Het
Dcstamp A G 15: 39,754,224 I10V probably benign Het
Fam208b T C 13: 3,581,831 D890G probably benign Het
Gm44501 T A 17: 40,576,616 F8L unknown Het
Gpr179 T C 11: 97,335,711 S1873G probably benign Het
Gprin2 C A 14: 34,194,797 A339S probably benign Het
Gucy1b2 T A 14: 62,411,589 I513F possibly damaging Het
Ighv5-6 T A 12: 113,625,588 R91* probably null Het
Igtp G A 11: 58,206,998 V332I possibly damaging Het
Itfg1 G A 8: 85,726,249 P497S probably damaging Het
Junb T C 8: 84,977,888 N181S possibly damaging Het
Lama3 T C 18: 12,481,088 Y1305H probably benign Het
Lrrcc1 A T 3: 14,551,443 N44I probably damaging Het
Med15 A T 16: 17,671,564 probably benign Het
Mkks T C 2: 136,880,574 E221G probably benign Het
Mtmr10 T C 7: 64,320,631 V374A possibly damaging Het
Muc5b G T 7: 141,868,450 C4441F possibly damaging Het
Nim1k G A 13: 119,712,174 Q395* probably null Het
Nlrp6 A G 7: 140,921,781 D87G probably damaging Het
Ntng1 C A 3: 110,143,808 probably benign Het
Padi1 G T 4: 140,817,270 probably benign Het
Rxrg T C 1: 167,625,027 S133P probably benign Het
Snx19 T C 9: 30,427,896 I110T probably benign Het
Strap T C 6: 137,749,336 probably benign Het
Tgtp2 A T 11: 49,059,352 M131K probably damaging Het
Tppp2 T C 14: 51,919,411 F82L probably damaging Het
Ttc39c A G 18: 12,730,069 K397E possibly damaging Het
Txlnb T TTA 10: 17,838,997 probably null Het
Usp36 T A 11: 118,285,795 R66W probably damaging Het
Vmn1r30 A T 6: 58,435,133 V238E probably damaging Het
Vmn1r6 A G 6: 57,003,189 I279V probably benign Het
Vmn2r61 G A 7: 42,300,696 D847N probably benign Het
Zfp622 G A 15: 25,987,051 probably null Het
Zfp963 T C 8: 69,744,485 I36V probably benign Het
Zfy2 A G Y: 2,107,351 Y428H possibly damaging Het
Other mutations in Atp8b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Atp8b5 APN 4 43355567 missense probably damaging 1.00
IGL00970:Atp8b5 APN 4 43311938 missense probably benign 0.01
IGL01335:Atp8b5 APN 4 43302628 missense possibly damaging 0.90
IGL01462:Atp8b5 APN 4 43368010 missense possibly damaging 0.90
IGL01657:Atp8b5 APN 4 43291693 missense probably benign 0.04
IGL01935:Atp8b5 APN 4 43366638 missense probably benign 0.03
IGL01977:Atp8b5 APN 4 43320590 critical splice acceptor site probably null
IGL02102:Atp8b5 APN 4 43364167 missense probably benign 0.10
IGL02369:Atp8b5 APN 4 43334205 missense probably benign
IGL02456:Atp8b5 APN 4 43365578 missense probably benign 0.16
IGL02696:Atp8b5 APN 4 43369634 missense possibly damaging 0.61
IGL02826:Atp8b5 APN 4 43366770 missense probably damaging 1.00
IGL02947:Atp8b5 APN 4 43305774 missense possibly damaging 0.49
R0128:Atp8b5 UTSW 4 43369715 critical splice donor site probably null
R0130:Atp8b5 UTSW 4 43369715 critical splice donor site probably null
R0243:Atp8b5 UTSW 4 43366057 missense probably benign
R0256:Atp8b5 UTSW 4 43302576 intron probably benign
R0379:Atp8b5 UTSW 4 43361898 missense probably damaging 0.99
R0671:Atp8b5 UTSW 4 43291672 missense possibly damaging 0.83
R1109:Atp8b5 UTSW 4 43305719 intron probably benign
R1442:Atp8b5 UTSW 4 43334313 missense probably damaging 0.99
R1454:Atp8b5 UTSW 4 43302590 missense probably benign
R1469:Atp8b5 UTSW 4 43291733 critical splice donor site probably null
R1469:Atp8b5 UTSW 4 43291733 critical splice donor site probably null
R1503:Atp8b5 UTSW 4 43344430 missense probably damaging 1.00
R1580:Atp8b5 UTSW 4 43355673 missense possibly damaging 0.49
R1677:Atp8b5 UTSW 4 43372903 missense possibly damaging 0.61
R1861:Atp8b5 UTSW 4 43372906 missense probably damaging 1.00
R1899:Atp8b5 UTSW 4 43361804 missense possibly damaging 0.47
R1903:Atp8b5 UTSW 4 43357063 missense probably damaging 0.98
R1961:Atp8b5 UTSW 4 43369688 missense probably damaging 0.98
R2131:Atp8b5 UTSW 4 43370726 missense probably benign 0.33
R2971:Atp8b5 UTSW 4 43361953 splice site probably benign
R3023:Atp8b5 UTSW 4 43311957 missense possibly damaging 0.82
R3433:Atp8b5 UTSW 4 43372697 missense probably benign
R3690:Atp8b5 UTSW 4 43368055 missense probably damaging 1.00
R4157:Atp8b5 UTSW 4 43365591 missense probably damaging 0.97
R4510:Atp8b5 UTSW 4 43320629 missense probably damaging 1.00
R4511:Atp8b5 UTSW 4 43320629 missense probably damaging 1.00
R4679:Atp8b5 UTSW 4 43365955 missense probably benign 0.16
R4753:Atp8b5 UTSW 4 43372710 missense probably damaging 1.00
R4761:Atp8b5 UTSW 4 43308504 makesense probably null
R4784:Atp8b5 UTSW 4 43356980 missense probably damaging 0.97
R4785:Atp8b5 UTSW 4 43356980 missense probably damaging 0.97
R4855:Atp8b5 UTSW 4 43344449 missense probably benign
R5422:Atp8b5 UTSW 4 43366644 missense probably benign 0.10
R5915:Atp8b5 UTSW 4 43370577 missense probably damaging 1.00
R6228:Atp8b5 UTSW 4 43304674 missense probably damaging 1.00
R6496:Atp8b5 UTSW 4 43371003 missense probably benign 0.03
R6708:Atp8b5 UTSW 4 43334249 missense probably benign
R6931:Atp8b5 UTSW 4 43364108 critical splice acceptor site probably null
R7021:Atp8b5 UTSW 4 43355618 missense probably damaging 0.99
R7085:Atp8b5 UTSW 4 43361835 missense probably damaging 1.00
R7207:Atp8b5 UTSW 4 43357018 missense probably damaging 0.97
R7404:Atp8b5 UTSW 4 43342640 missense probably benign 0.10
R7448:Atp8b5 UTSW 4 43366021 missense probably benign
R7465:Atp8b5 UTSW 4 43271269 missense probably benign 0.00
R7526:Atp8b5 UTSW 4 43366609 missense probably damaging 0.99
X0025:Atp8b5 UTSW 4 43366774 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGCCTCCAAAGGTAGCAC -3'
(R):5'- ATTTGGAAATGTGGTCAGTGAGAC -3'

Sequencing Primer
(F):5'- TAGCACAGAAACAAATGTTATGGG -3'
(R):5'- TGTCCAACTGAAGAAAACTGATGTC -3'
Posted On2015-07-21