Incidental Mutation 'R4484:Crtc3'
ID331533
Institutional Source Beutler Lab
Gene Symbol Crtc3
Ensembl Gene ENSMUSG00000030527
Gene NameCREB regulated transcription coactivator 3
Synonyms
MMRRC Submission 041740-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R4484 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location80586627-80688877 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80589948 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 552 (D552G)
Ref Sequence ENSEMBL: ENSMUSP00000113540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122255]
Predicted Effect probably damaging
Transcript: ENSMUST00000122255
AA Change: D552G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113540
Gene: ENSMUSG00000030527
AA Change: D552G

DomainStartEndE-ValueType
Pfam:TORC_N 11 82 1.2e-20 PFAM
Pfam:TORC_M 159 321 1.9e-64 PFAM
low complexity region 366 380 N/A INTRINSIC
low complexity region 438 480 N/A INTRINSIC
Pfam:TORC_C 545 619 2.2e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149176
Meta Mutation Damage Score 0.1244 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the CREB regulated transcription coactivator gene family. This family regulates CREB-dependent gene transcription in a phosphorylation-independent manner and may be selective for cAMP-responsive genes. The protein encoded by this gene may induce mitochondrial biogenesis and attenuate catecholamine signaling in adipose tissue. A translocation event between this gene and Notch coactivator mastermind-like gene 2, which results in a fusion protein, has been reported in mucoepidermoid carcinomas. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null mutation display resistance to diet-induced obesity, increased energy expenditure, decreased white adipose tissue mass, increased brown adipose cell numbers, and increased core temperature. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox4 T C 1: 58,262,571 C1101R probably damaging Het
Atp8b5 T C 4: 43,357,016 I588T probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
BC067074 A T 13: 113,319,199 N593I probably damaging Het
Cd164l2 T A 4: 133,223,675 V147E probably damaging Het
Celsr3 G A 9: 108,846,063 probably null Het
Cr2 T C 1: 195,154,174 T894A probably damaging Het
Cyp2c50 A G 19: 40,090,639 E142G probably damaging Het
Dcstamp A G 15: 39,754,224 I10V probably benign Het
Fam208b T C 13: 3,581,831 D890G probably benign Het
Gm44501 T A 17: 40,576,616 F8L unknown Het
Gpr179 T C 11: 97,335,711 S1873G probably benign Het
Gprin2 C A 14: 34,194,797 A339S probably benign Het
Gucy1b2 T A 14: 62,411,589 I513F possibly damaging Het
Ighv5-6 T A 12: 113,625,588 R91* probably null Het
Igtp G A 11: 58,206,998 V332I possibly damaging Het
Itfg1 G A 8: 85,726,249 P497S probably damaging Het
Junb T C 8: 84,977,888 N181S possibly damaging Het
Lama3 T C 18: 12,481,088 Y1305H probably benign Het
Lrrcc1 A T 3: 14,551,443 N44I probably damaging Het
Med15 A T 16: 17,671,564 probably benign Het
Mkks T C 2: 136,880,574 E221G probably benign Het
Mtmr10 T C 7: 64,320,631 V374A possibly damaging Het
Muc5b G T 7: 141,868,450 C4441F possibly damaging Het
Nim1k G A 13: 119,712,174 Q395* probably null Het
Nlrp6 A G 7: 140,921,781 D87G probably damaging Het
Ntng1 C A 3: 110,143,808 probably benign Het
Padi1 G T 4: 140,817,270 probably benign Het
Rxrg T C 1: 167,625,027 S133P probably benign Het
Snx19 T C 9: 30,427,896 I110T probably benign Het
Strap T C 6: 137,749,336 probably benign Het
Tgtp2 A T 11: 49,059,352 M131K probably damaging Het
Tppp2 T C 14: 51,919,411 F82L probably damaging Het
Ttc39c A G 18: 12,730,069 K397E possibly damaging Het
Txlnb T TTA 10: 17,838,997 probably null Het
Usp36 T A 11: 118,285,795 R66W probably damaging Het
Vmn1r30 A T 6: 58,435,133 V238E probably damaging Het
Vmn1r6 A G 6: 57,003,189 I279V probably benign Het
Vmn2r61 G A 7: 42,300,696 D847N probably benign Het
Zfp622 G A 15: 25,987,051 probably null Het
Zfp963 T C 8: 69,744,485 I36V probably benign Het
Zfy2 A G Y: 2,107,351 Y428H possibly damaging Het
Other mutations in Crtc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:Crtc3 APN 7 80598739 intron probably benign
IGL01325:Crtc3 APN 7 80677368 missense probably damaging 0.96
IGL01802:Crtc3 APN 7 80604368 nonsense probably null
IGL02166:Crtc3 APN 7 80677399 missense probably damaging 1.00
IGL02601:Crtc3 APN 7 80592567 missense probably damaging 1.00
IGL02719:Crtc3 APN 7 80618658 critical splice acceptor site probably null
IGL02936:Crtc3 APN 7 80589763 missense probably damaging 1.00
IGL03075:Crtc3 APN 7 80604403 intron probably benign
R0856:Crtc3 UTSW 7 80595624 missense probably damaging 0.99
R1655:Crtc3 UTSW 7 80598776 missense possibly damaging 0.67
R1962:Crtc3 UTSW 7 80589931 missense probably damaging 1.00
R4533:Crtc3 UTSW 7 80589795 missense probably damaging 0.97
R4818:Crtc3 UTSW 7 80677422 missense possibly damaging 0.65
R5292:Crtc3 UTSW 7 80618610 missense possibly damaging 0.94
R5908:Crtc3 UTSW 7 80595794 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- ATAGCCGGTCAGCTCGAAAC -3'
(R):5'- GCAGCATTAGGTAAATGAAACCC -3'

Sequencing Primer
(F):5'- GTCAGCTCGAAACGTCTCC -3'
(R):5'- GGCAGTACACATCTGTCATTCGAG -3'
Posted On2015-07-21