Mutagenetix > Incidental Mutation

Incidental Mutation 'R4484:Nlrp6'

331534

Institutional Source

Beutler Lab

Gene Symbol

Nlrp6

Ensembl Gene

ENSMUSG00000038745

Gene Name

NLR family, pyrin domain containing 6

Synonyms

Nalp6

MMRRC Submission

041740-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

R4484 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

140920902-140929192 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 140921781 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 87 (D87G)

Ref Sequence

ENSEMBL: ENSMUSP00000139170 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000106045] [ENSMUST00000183845] [ENSMUST00000184560]

AlphaFold

Q91WS2

Predicted Effect

probably damaging
Transcript: ENSMUST00000106045
AA Change: D57G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101660
Gene: ENSMUSG00000038745
AA Change: D57G

Domain	Start	End	E-Value	Type
PYRIN	15	96	5.44e-27	SMART
low complexity region	158	169	N/A	INTRINSIC
Pfam:NACHT	194	363	8.6e-44	PFAM
coiled coil region	590	617	N/A	INTRINSIC
low complexity region	675	697	N/A	INTRINSIC
internal_repeat_1	715	763	9.43e-6	PROSPERO
internal_repeat_1	828	876	9.43e-6	PROSPERO

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183761

Predicted Effect

probably damaging
Transcript: ENSMUST00000183845
AA Change: D57G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000139357
Gene: ENSMUSG00000038745
AA Change: D57G

Domain	Start	End	E-Value	Type
PYRIN	15	96	5.44e-27	SMART
low complexity region	158	169	N/A	INTRINSIC
Pfam:NACHT	194	363	5.5e-43	PFAM
coiled coil region	590	617	N/A	INTRINSIC
low complexity region	680	694	N/A	INTRINSIC
internal_repeat_1	702	750	1.26e-5	PROSPERO
internal_repeat_1	815	863	1.26e-5	PROSPERO

Predicted Effect

probably damaging
Transcript: ENSMUST00000184560
AA Change: D87G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139170
Gene: ENSMUSG00000038745
AA Change: D87G

Domain	Start	End	E-Value	Type
PYRIN	45	126	5.44e-27	SMART
low complexity region	188	199	N/A	INTRINSIC
Pfam:NACHT	224	393	8.2e-43	PFAM
coiled coil region	620	647	N/A	INTRINSIC
low complexity region	710	724	N/A	INTRINSIC
internal_repeat_1	732	780	1.55e-5	PROSPERO
internal_repeat_1	845	893	1.55e-5	PROSPERO

Meta Mutation Damage Score

0.2937

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

98% (46/47)

MGI Phenotype

FUNCTION: The protein encoded by this gene binds arginine-vasopressin and may be involved in the arginine-vasopressin-mediated regulation of renal salt-water balance. The encoded protein also mediates inflammatory responses in the colon to allow recovery from intestinal epithelial damage and protects against tumorigenesis and the development of colitis. Finally, this protein can increase activation of NF-kappa-B, activation of CASP1 through interaction with ASC, and cAMP accumulation. [provided by RefSeq, Feb 2013]
PHENOTYPE: Nullizygous mutations lead to altered colonic microbiota, increased susceptibility to induced colitis and/or inflammation-associated colon tumorigenesis. Homozygotes for a null allele show lower blood pressure and sex-specific changes in urine concentrating ability, cognition, and anxiety behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aox4	T	C	1: 58,262,571	C1101R	probably damaging	Het
Atp8b5	T	C	4: 43,357,016	I588T	probably damaging	Het
Bahd1	C	T	2: 118,916,406	P169S	probably damaging	Het
BC067074	A	T	13: 113,319,199	N593I	probably damaging	Het
Cd164l2	T	A	4: 133,223,675	V147E	probably damaging	Het
Celsr3	G	A	9: 108,846,063		probably null	Het
Cr2	T	C	1: 195,154,174	T894A	probably damaging	Het
Crtc3	T	C	7: 80,589,948	D552G	probably damaging	Het
Cyp2c50	A	G	19: 40,090,639	E142G	probably damaging	Het
Dcstamp	A	G	15: 39,754,224	I10V	probably benign	Het
Fam208b	T	C	13: 3,581,831	D890G	probably benign	Het
Gm44501	T	A	17: 40,576,616	F8L	unknown	Het
Gpr179	T	C	11: 97,335,711	S1873G	probably benign	Het
Gprin2	C	A	14: 34,194,797	A339S	probably benign	Het
Gucy1b2	T	A	14: 62,411,589	I513F	possibly damaging	Het
Ighv5-6	T	A	12: 113,625,588	R91*	probably null	Het
Igtp	G	A	11: 58,206,998	V332I	possibly damaging	Het
Itfg1	G	A	8: 85,726,249	P497S	probably damaging	Het
Junb	T	C	8: 84,977,888	N181S	possibly damaging	Het
Lama3	T	C	18: 12,481,088	Y1305H	probably benign	Het
Lrrcc1	A	T	3: 14,551,443	N44I	probably damaging	Het
Med15	A	T	16: 17,671,564		probably benign	Het
Mkks	T	C	2: 136,880,574	E221G	probably benign	Het
Mtmr10	T	C	7: 64,320,631	V374A	possibly damaging	Het
Muc5b	G	T	7: 141,868,450	C4441F	possibly damaging	Het
Nim1k	G	A	13: 119,712,174	Q395*	probably null	Het
Ntng1	C	A	3: 110,143,808		probably benign	Het
Padi1	G	T	4: 140,817,270		probably benign	Het
Rxrg	T	C	1: 167,625,027	S133P	probably benign	Het
Snx19	T	C	9: 30,427,896	I110T	probably benign	Het
Strap	T	C	6: 137,749,336		probably benign	Het
Tgtp2	A	T	11: 49,059,352	M131K	probably damaging	Het
Tppp2	T	C	14: 51,919,411	F82L	probably damaging	Het
Ttc39c	A	G	18: 12,730,069	K397E	possibly damaging	Het
Txlnb	T	TTA	10: 17,838,997		probably null	Het
Usp36	T	A	11: 118,285,795	R66W	probably damaging	Het
Vmn1r30	A	T	6: 58,435,133	V238E	probably damaging	Het
Vmn1r6	A	G	6: 57,003,189	I279V	probably benign	Het
Vmn2r61	G	A	7: 42,300,696	D847N	probably benign	Het
Zfp622	G	A	15: 25,987,051		probably null	Het
Zfp963	T	C	8: 69,744,485	I36V	probably benign	Het
Zfy2	A	G	Y: 2,107,351	Y428H	possibly damaging	Het

Other mutations in Nlrp6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00561:Nlrp6	APN	7	140923124	missense	probably damaging	1.00
IGL01066:Nlrp6	APN	7	140921796	missense	possibly damaging	0.88
IGL01966:Nlrp6	APN	7	140925190	missense	probably damaging	1.00
IGL02625:Nlrp6	APN	7	140923500	missense	probably benign	0.00
IGL02792:Nlrp6	APN	7	140922435	missense	probably damaging	0.97
IGL02813:Nlrp6	APN	7	140923420	missense	possibly damaging	0.86
IGL03140:Nlrp6	APN	7	140927487	missense	probably benign	0.01
R0608:Nlrp6	UTSW	7	140923486	nonsense	probably null
R1404:Nlrp6	UTSW	7	140924113	small deletion	probably benign
R1404:Nlrp6	UTSW	7	140924113	small deletion	probably benign
R1472:Nlrp6	UTSW	7	140923495	missense	probably damaging	1.00
R1587:Nlrp6	UTSW	7	140923046	missense	probably damaging	1.00
R1843:Nlrp6	UTSW	7	140923093	missense	probably damaging	1.00
R1959:Nlrp6	UTSW	7	140924113	small deletion	probably benign
R2097:Nlrp6	UTSW	7	140923204	missense	probably damaging	1.00
R2118:Nlrp6	UTSW	7	140926444	missense	probably benign	0.11
R2119:Nlrp6	UTSW	7	140926444	missense	probably benign	0.11
R2120:Nlrp6	UTSW	7	140926444	missense	probably benign	0.11
R2121:Nlrp6	UTSW	7	140926444	missense	probably benign	0.11
R2290:Nlrp6	UTSW	7	140922163	missense	probably damaging	1.00
R3546:Nlrp6	UTSW	7	140926769	missense	probably benign	0.00
R3547:Nlrp6	UTSW	7	140926769	missense	probably benign	0.00
R3970:Nlrp6	UTSW	7	140921655	missense	probably damaging	1.00
R4483:Nlrp6	UTSW	7	140921781	missense	probably damaging	1.00
R4869:Nlrp6	UTSW	7	140924093	missense	probably damaging	1.00
R4962:Nlrp6	UTSW	7	140923584	missense	probably damaging	0.99
R5436:Nlrp6	UTSW	7	140922717	nonsense	probably null
R5442:Nlrp6	UTSW	7	140922190	missense	probably benign	0.01
R5924:Nlrp6	UTSW	7	140923490	missense	probably damaging	1.00
R5936:Nlrp6	UTSW	7	140922812	nonsense	probably null
R6124:Nlrp6	UTSW	7	140923247	missense	probably damaging	1.00
R6455:Nlrp6	UTSW	7	140927509	missense	possibly damaging	0.65
R6480:Nlrp6	UTSW	7	140927443	missense	possibly damaging	0.93
R6873:Nlrp6	UTSW	7	140923520	missense	probably benign	0.01
R7061:Nlrp6	UTSW	7	140922867	missense	probably benign	0.36
R7350:Nlrp6	UTSW	7	140921278	start gained	probably benign
R7532:Nlrp6	UTSW	7	140925184	missense	probably benign	0.00
R7752:Nlrp6	UTSW	7	140927440	missense	possibly damaging	0.92
R7901:Nlrp6	UTSW	7	140927440	missense	possibly damaging	0.92
R8098:Nlrp6	UTSW	7	140923255	missense	probably damaging	1.00
R8381:Nlrp6	UTSW	7	140923841	missense	possibly damaging	0.47
R8513:Nlrp6	UTSW	7	140922830	missense	possibly damaging	0.83
R9114:Nlrp6	UTSW	7	140926419	missense	probably damaging	1.00
V7732:Nlrp6	UTSW	7	140926648	splice site	probably benign
Z1176:Nlrp6	UTSW	7	140922721	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTCAGGTCGCATCAGTGATG -3'
(R):5'- AGTGGACAAAGTTGATCTTCCC -3'

Sequencing Primer
(F):5'- TCAGGTCGCATCAGTGATGATAACC -3'
(R):5'- GTTGATCTTCCCAAGGAGAGC -3'

Posted On

2015-07-21