Incidental Mutation 'R4484:Junb'
ID331537
Institutional Source Beutler Lab
Gene Symbol Junb
Ensembl Gene ENSMUSG00000052837
Gene Namejun B proto-oncogene
Synonyms
MMRRC Submission 041740-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4484 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location84974484-84978718 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84977888 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 181 (N181S)
Ref Sequence ENSEMBL: ENSMUSP00000064680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005292] [ENSMUST00000064922] [ENSMUST00000109733] [ENSMUST00000109734] [ENSMUST00000164807]
Predicted Effect probably benign
Transcript: ENSMUST00000005292
SMART Domains Protein: ENSMUSP00000005292
Gene: ENSMUSG00000005161

DomainStartEndE-ValueType
Pfam:Redoxin 7 157 3.9e-20 PFAM
Pfam:AhpC-TSA 8 141 5.6e-44 PFAM
Pfam:1-cysPrx_C 161 196 8.6e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000064922
AA Change: N181S

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000064680
Gene: ENSMUSG00000052837
AA Change: N181S

DomainStartEndE-ValueType
Pfam:Jun 5 254 6.1e-81 PFAM
BRLZ 263 327 1.77e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109733
SMART Domains Protein: ENSMUSP00000105355
Gene: ENSMUSG00000005161

DomainStartEndE-ValueType
Pfam:Redoxin 7 159 1.3e-21 PFAM
Pfam:AhpC-TSA 8 141 1.3e-44 PFAM
Pfam:1-cysPrx_C 161 196 8.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109734
SMART Domains Protein: ENSMUSP00000105356
Gene: ENSMUSG00000005161

DomainStartEndE-ValueType
Pfam:Redoxin 7 159 1.3e-21 PFAM
Pfam:AhpC-TSA 8 141 1.3e-44 PFAM
Pfam:1-cysPrx_C 161 196 8.6e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127215
Predicted Effect probably benign
Transcript: ENSMUST00000164807
SMART Domains Protein: ENSMUSP00000126451
Gene: ENSMUSG00000005161

DomainStartEndE-ValueType
Pfam:Redoxin 7 159 1.3e-21 PFAM
Pfam:AhpC-TSA 8 141 1.3e-44 PFAM
Pfam:1-cysPrx_C 161 196 8.6e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209372
Meta Mutation Damage Score 0.2032 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (46/47)
MGI Phenotype PHENOTYPE: Homozygous null mutants die between embryonic day 8.5-10 due to impaired placental development. Embryos are severely growth retarded, but cell proliferation is normal, reflecting a failure to establish vascular interactions with the maternal circulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox4 T C 1: 58,262,571 C1101R probably damaging Het
Atp8b5 T C 4: 43,357,016 I588T probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
BC067074 A T 13: 113,319,199 N593I probably damaging Het
Cd164l2 T A 4: 133,223,675 V147E probably damaging Het
Celsr3 G A 9: 108,846,063 probably null Het
Cr2 T C 1: 195,154,174 T894A probably damaging Het
Crtc3 T C 7: 80,589,948 D552G probably damaging Het
Cyp2c50 A G 19: 40,090,639 E142G probably damaging Het
Dcstamp A G 15: 39,754,224 I10V probably benign Het
Fam208b T C 13: 3,581,831 D890G probably benign Het
Gm44501 T A 17: 40,576,616 F8L unknown Het
Gpr179 T C 11: 97,335,711 S1873G probably benign Het
Gprin2 C A 14: 34,194,797 A339S probably benign Het
Gucy1b2 T A 14: 62,411,589 I513F possibly damaging Het
Ighv5-6 T A 12: 113,625,588 R91* probably null Het
Igtp G A 11: 58,206,998 V332I possibly damaging Het
Itfg1 G A 8: 85,726,249 P497S probably damaging Het
Lama3 T C 18: 12,481,088 Y1305H probably benign Het
Lrrcc1 A T 3: 14,551,443 N44I probably damaging Het
Med15 A T 16: 17,671,564 probably benign Het
Mkks T C 2: 136,880,574 E221G probably benign Het
Mtmr10 T C 7: 64,320,631 V374A possibly damaging Het
Muc5b G T 7: 141,868,450 C4441F possibly damaging Het
Nim1k G A 13: 119,712,174 Q395* probably null Het
Nlrp6 A G 7: 140,921,781 D87G probably damaging Het
Ntng1 C A 3: 110,143,808 probably benign Het
Padi1 G T 4: 140,817,270 probably benign Het
Rxrg T C 1: 167,625,027 S133P probably benign Het
Snx19 T C 9: 30,427,896 I110T probably benign Het
Strap T C 6: 137,749,336 probably benign Het
Tgtp2 A T 11: 49,059,352 M131K probably damaging Het
Tppp2 T C 14: 51,919,411 F82L probably damaging Het
Ttc39c A G 18: 12,730,069 K397E possibly damaging Het
Txlnb T TTA 10: 17,838,997 probably null Het
Usp36 T A 11: 118,285,795 R66W probably damaging Het
Vmn1r30 A T 6: 58,435,133 V238E probably damaging Het
Vmn1r6 A G 6: 57,003,189 I279V probably benign Het
Vmn2r61 G A 7: 42,300,696 D847N probably benign Het
Zfp622 G A 15: 25,987,051 probably null Het
Zfp963 T C 8: 69,744,485 I36V probably benign Het
Zfy2 A G Y: 2,107,351 Y428H possibly damaging Het
Other mutations in Junb
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0032:Junb UTSW 8 84977786 missense probably benign 0.45
R0347:Junb UTSW 8 84978478 unclassified probably benign
R1219:Junb UTSW 8 84977639 missense probably damaging 1.00
R1513:Junb UTSW 8 84978129 missense probably damaging 1.00
R1628:Junb UTSW 8 84978410 missense possibly damaging 0.93
R2655:Junb UTSW 8 84977508 missense probably damaging 1.00
R4718:Junb UTSW 8 84978432 unclassified probably benign
R4965:Junb UTSW 8 84978159 missense probably damaging 1.00
R5916:Junb UTSW 8 84977876 missense probably benign 0.00
R6262:Junb UTSW 8 84977730 missense possibly damaging 0.83
R6899:Junb UTSW 8 84977724 missense probably benign 0.00
R7355:Junb UTSW 8 84978384 missense probably benign
R7586:Junb UTSW 8 84978173 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTTCCTCTTTAAAGGCGGAAG -3'
(R):5'- CGGGACAGTACTTTTACCCC -3'

Sequencing Primer
(F):5'- AAGCGCCGCGACTCAAG -3'
(R):5'- GGACAGTACTTTTACCCCCGTGG -3'
Posted On2015-07-21