Incidental Mutation 'R4484:Itfg1'
ID331538
Institutional Source Beutler Lab
Gene Symbol Itfg1
Ensembl Gene ENSMUSG00000031703
Gene Nameintegrin alpha FG-GAP repeat containing 1
SynonymsD8Wsu49e, 2310047C21Rik
MMRRC Submission 041740-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R4484 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location85717578-85840921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 85726249 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 497 (P497S)
Ref Sequence ENSEMBL: ENSMUSP00000034140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034140]
Predicted Effect probably damaging
Transcript: ENSMUST00000034140
AA Change: P497S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034140
Gene: ENSMUSG00000031703
AA Change: P497S

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
SCOP:d1m1xa4 46 232 5e-3 SMART
low complexity region 482 496 N/A INTRINSIC
transmembrane domain 564 586 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210912
Meta Mutation Damage Score 0.9016 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox4 T C 1: 58,262,571 C1101R probably damaging Het
Atp8b5 T C 4: 43,357,016 I588T probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
BC067074 A T 13: 113,319,199 N593I probably damaging Het
Cd164l2 T A 4: 133,223,675 V147E probably damaging Het
Celsr3 G A 9: 108,846,063 probably null Het
Cr2 T C 1: 195,154,174 T894A probably damaging Het
Crtc3 T C 7: 80,589,948 D552G probably damaging Het
Cyp2c50 A G 19: 40,090,639 E142G probably damaging Het
Dcstamp A G 15: 39,754,224 I10V probably benign Het
Fam208b T C 13: 3,581,831 D890G probably benign Het
Gm44501 T A 17: 40,576,616 F8L unknown Het
Gpr179 T C 11: 97,335,711 S1873G probably benign Het
Gprin2 C A 14: 34,194,797 A339S probably benign Het
Gucy1b2 T A 14: 62,411,589 I513F possibly damaging Het
Ighv5-6 T A 12: 113,625,588 R91* probably null Het
Igtp G A 11: 58,206,998 V332I possibly damaging Het
Junb T C 8: 84,977,888 N181S possibly damaging Het
Lama3 T C 18: 12,481,088 Y1305H probably benign Het
Lrrcc1 A T 3: 14,551,443 N44I probably damaging Het
Med15 A T 16: 17,671,564 probably benign Het
Mkks T C 2: 136,880,574 E221G probably benign Het
Mtmr10 T C 7: 64,320,631 V374A possibly damaging Het
Muc5b G T 7: 141,868,450 C4441F possibly damaging Het
Nim1k G A 13: 119,712,174 Q395* probably null Het
Nlrp6 A G 7: 140,921,781 D87G probably damaging Het
Ntng1 C A 3: 110,143,808 probably benign Het
Padi1 G T 4: 140,817,270 probably benign Het
Rxrg T C 1: 167,625,027 S133P probably benign Het
Snx19 T C 9: 30,427,896 I110T probably benign Het
Strap T C 6: 137,749,336 probably benign Het
Tgtp2 A T 11: 49,059,352 M131K probably damaging Het
Tppp2 T C 14: 51,919,411 F82L probably damaging Het
Ttc39c A G 18: 12,730,069 K397E possibly damaging Het
Txlnb T TTA 10: 17,838,997 probably null Het
Usp36 T A 11: 118,285,795 R66W probably damaging Het
Vmn1r30 A T 6: 58,435,133 V238E probably damaging Het
Vmn1r6 A G 6: 57,003,189 I279V probably benign Het
Vmn2r61 G A 7: 42,300,696 D847N probably benign Het
Zfp622 G A 15: 25,987,051 probably null Het
Zfp963 T C 8: 69,744,485 I36V probably benign Het
Zfy2 A G Y: 2,107,351 Y428H possibly damaging Het
Other mutations in Itfg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02579:Itfg1 APN 8 85780565 missense possibly damaging 0.95
IGL02803:Itfg1 APN 8 85725511 splice site probably null
R0368:Itfg1 UTSW 8 85764407 missense probably damaging 1.00
R0755:Itfg1 UTSW 8 85726205 missense possibly damaging 0.90
R1183:Itfg1 UTSW 8 85780523 missense probably benign 0.04
R1529:Itfg1 UTSW 8 85810614 missense probably benign 0.02
R1789:Itfg1 UTSW 8 85725512 critical splice donor site probably null
R1953:Itfg1 UTSW 8 85831231 missense probably benign 0.31
R2206:Itfg1 UTSW 8 85776198 missense probably benign 0.17
R2207:Itfg1 UTSW 8 85776198 missense probably benign 0.17
R2260:Itfg1 UTSW 8 85722677 missense probably damaging 1.00
R2358:Itfg1 UTSW 8 85738129 missense probably damaging 1.00
R2876:Itfg1 UTSW 8 85780510 splice site probably benign
R2990:Itfg1 UTSW 8 85835049 missense possibly damaging 0.82
R4762:Itfg1 UTSW 8 85732441 missense possibly damaging 0.95
R5146:Itfg1 UTSW 8 85718868 makesense probably null
R5796:Itfg1 UTSW 8 85718893 missense probably damaging 1.00
R5805:Itfg1 UTSW 8 85766972 missense probably benign 0.04
R6084:Itfg1 UTSW 8 85726170 missense probably benign 0.01
R6187:Itfg1 UTSW 8 85836465 missense probably damaging 1.00
R6319:Itfg1 UTSW 8 85840629 missense probably damaging 1.00
R6463:Itfg1 UTSW 8 85736151 missense probably benign 0.03
R6490:Itfg1 UTSW 8 85740301 missense probably benign 0.08
R6492:Itfg1 UTSW 8 85740349 missense probably benign 0.14
R6588:Itfg1 UTSW 8 85736130 missense probably benign
R6753:Itfg1 UTSW 8 85835078 missense probably benign 0.04
R7489:Itfg1 UTSW 8 85767001 missense probably damaging 1.00
R7665:Itfg1 UTSW 8 85764350 missense probably benign
X0067:Itfg1 UTSW 8 85840753 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CAAGTCAGGAATTTGTGTGAGTAC -3'
(R):5'- CATTGTACTCACTGAGGTGACC -3'

Sequencing Primer
(F):5'- GTCAGGAATTTGTGTGAGTACAATAC -3'
(R):5'- GAGGTGACCTCTTAGGATATTCTC -3'
Posted On2015-07-21