Incidental Mutation 'R4484:Snx19'
List |< first << previous [record 31 of 43] next >> last >|
ID331539
Institutional Source Beutler Lab
Gene Symbol Snx19
Ensembl Gene ENSMUSG00000031993
Gene Namesorting nexin 19
Synonyms3526401K03Rik
MMRRC Submission 041740-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R4484 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location30427108-30466733 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30427896 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 110 (I110T)
Ref Sequence ENSEMBL: ENSMUSP00000131895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164099]
Predicted Effect probably benign
Transcript: ENSMUST00000164099
AA Change: I110T

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000131895
Gene: ENSMUSG00000031993
AA Change: I110T

DomainStartEndE-ValueType
transmembrane domain 29 46 N/A INTRINSIC
transmembrane domain 51 73 N/A INTRINSIC
Pfam:PXA 96 269 2.9e-43 PFAM
low complexity region 324 335 N/A INTRINSIC
low complexity region 371 385 N/A INTRINSIC
low complexity region 504 528 N/A INTRINSIC
PX 533 664 1.83e-24 SMART
Pfam:Nexin_C 843 951 1.9e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216552
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217174
Meta Mutation Damage Score 0.0736 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Islet antigen-2 (IA-2) is an autoantigen in type 1 diabetes and plays a role in insulin secretion. IA-2 is found in dense-core secretory vesicles and interacts with the product of this gene, a sorting nexin. In mouse pancreatic beta-cells, the encoded protein influenced insulin secretion by stabilizing the number of dense-core secretory vesicles. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox4 T C 1: 58,262,571 C1101R probably damaging Het
Atp8b5 T C 4: 43,357,016 I588T probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
BC067074 A T 13: 113,319,199 N593I probably damaging Het
Cd164l2 T A 4: 133,223,675 V147E probably damaging Het
Celsr3 G A 9: 108,846,063 probably null Het
Cr2 T C 1: 195,154,174 T894A probably damaging Het
Crtc3 T C 7: 80,589,948 D552G probably damaging Het
Cyp2c50 A G 19: 40,090,639 E142G probably damaging Het
Dcstamp A G 15: 39,754,224 I10V probably benign Het
Fam208b T C 13: 3,581,831 D890G probably benign Het
Gm44501 T A 17: 40,576,616 F8L unknown Het
Gpr179 T C 11: 97,335,711 S1873G probably benign Het
Gprin2 C A 14: 34,194,797 A339S probably benign Het
Gucy1b2 T A 14: 62,411,589 I513F possibly damaging Het
Ighv5-6 T A 12: 113,625,588 R91* probably null Het
Igtp G A 11: 58,206,998 V332I possibly damaging Het
Itfg1 G A 8: 85,726,249 P497S probably damaging Het
Junb T C 8: 84,977,888 N181S possibly damaging Het
Lama3 T C 18: 12,481,088 Y1305H probably benign Het
Lrrcc1 A T 3: 14,551,443 N44I probably damaging Het
Med15 A T 16: 17,671,564 probably benign Het
Mkks T C 2: 136,880,574 E221G probably benign Het
Mtmr10 T C 7: 64,320,631 V374A possibly damaging Het
Muc5b G T 7: 141,868,450 C4441F possibly damaging Het
Nim1k G A 13: 119,712,174 Q395* probably null Het
Nlrp6 A G 7: 140,921,781 D87G probably damaging Het
Ntng1 C A 3: 110,143,808 probably benign Het
Padi1 G T 4: 140,817,270 probably benign Het
Rxrg T C 1: 167,625,027 S133P probably benign Het
Strap T C 6: 137,749,336 probably benign Het
Tgtp2 A T 11: 49,059,352 M131K probably damaging Het
Tppp2 T C 14: 51,919,411 F82L probably damaging Het
Ttc39c A G 18: 12,730,069 K397E possibly damaging Het
Txlnb T TTA 10: 17,838,997 probably null Het
Usp36 T A 11: 118,285,795 R66W probably damaging Het
Vmn1r30 A T 6: 58,435,133 V238E probably damaging Het
Vmn1r6 A G 6: 57,003,189 I279V probably benign Het
Vmn2r61 G A 7: 42,300,696 D847N probably benign Het
Zfp622 G A 15: 25,987,051 probably null Het
Zfp963 T C 8: 69,744,485 I36V probably benign Het
Zfy2 A G Y: 2,107,351 Y428H possibly damaging Het
Other mutations in Snx19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Snx19 APN 9 30429084 missense possibly damaging 0.92
IGL00498:Snx19 APN 9 30428937 missense possibly damaging 0.92
IGL00718:Snx19 APN 9 30432326 missense probably damaging 1.00
IGL00902:Snx19 APN 9 30428732 missense possibly damaging 0.90
IGL01433:Snx19 APN 9 30428771 missense possibly damaging 0.93
IGL01668:Snx19 APN 9 30427823 missense probably benign
IGL01732:Snx19 APN 9 30462353 missense probably damaging 1.00
IGL01767:Snx19 APN 9 30463264 missense possibly damaging 0.95
IGL02638:Snx19 APN 9 30432364 missense possibly damaging 0.52
IGL02718:Snx19 APN 9 30432260 missense possibly damaging 0.72
IGL02719:Snx19 APN 9 30432260 missense possibly damaging 0.72
IGL02723:Snx19 APN 9 30432260 missense possibly damaging 0.72
IGL02724:Snx19 APN 9 30432260 missense possibly damaging 0.72
IGL02725:Snx19 APN 9 30432260 missense possibly damaging 0.72
IGL02892:Snx19 APN 9 30428364 missense probably damaging 1.00
IGL03061:Snx19 APN 9 30433632 missense probably damaging 0.99
IGL03402:Snx19 APN 9 30440134 missense possibly damaging 0.89
R0125:Snx19 UTSW 9 30440219 missense probably damaging 1.00
R0133:Snx19 UTSW 9 30428616 missense possibly damaging 0.94
R0196:Snx19 UTSW 9 30433387 missense probably damaging 1.00
R0423:Snx19 UTSW 9 30435837 missense probably damaging 1.00
R0635:Snx19 UTSW 9 30428810 missense probably damaging 1.00
R0635:Snx19 UTSW 9 30428811 missense probably damaging 1.00
R1068:Snx19 UTSW 9 30429018 missense probably damaging 0.99
R1570:Snx19 UTSW 9 30428343 missense probably damaging 1.00
R1727:Snx19 UTSW 9 30433366 missense probably damaging 1.00
R1895:Snx19 UTSW 9 30432324 missense probably damaging 1.00
R1907:Snx19 UTSW 9 30433576 missense probably damaging 0.99
R1946:Snx19 UTSW 9 30432324 missense probably damaging 1.00
R1989:Snx19 UTSW 9 30428108 missense possibly damaging 0.93
R2029:Snx19 UTSW 9 30429000 missense probably benign 0.01
R2914:Snx19 UTSW 9 30433532 unclassified probably benign
R3880:Snx19 UTSW 9 30462392 missense probably damaging 1.00
R4223:Snx19 UTSW 9 30428448 missense possibly damaging 0.95
R4415:Snx19 UTSW 9 30437483 missense probably damaging 0.99
R4438:Snx19 UTSW 9 30428599 missense probably benign 0.01
R4585:Snx19 UTSW 9 30440195 missense probably damaging 1.00
R4765:Snx19 UTSW 9 30440157 missense probably damaging 1.00
R4771:Snx19 UTSW 9 30433638 missense probably damaging 1.00
R4922:Snx19 UTSW 9 30437467 missense probably benign 0.25
R5096:Snx19 UTSW 9 30428786 missense probably benign 0.40
R5464:Snx19 UTSW 9 30427973 missense possibly damaging 0.54
R6469:Snx19 UTSW 9 30427743 missense possibly damaging 0.50
R6886:Snx19 UTSW 9 30428935 missense probably damaging 1.00
R6988:Snx19 UTSW 9 30428935 missense probably damaging 1.00
R7131:Snx19 UTSW 9 30427893 missense probably damaging 1.00
R7268:Snx19 UTSW 9 30440177 missense probably damaging 1.00
R7772:Snx19 UTSW 9 30428925 missense probably damaging 0.99
X0019:Snx19 UTSW 9 30437366 missense probably damaging 1.00
X0024:Snx19 UTSW 9 30427721 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCCACCTTCTGGTCAACATGTG -3'
(R):5'- GCCTCCTTTGCCTGAATATAGC -3'

Sequencing Primer
(F):5'- GGTCAACATGTGGCTTCTGATCC -3'
(R):5'- CCTGAATATAGCTCTGCAGGTGAC -3'
Posted On2015-07-21