Incidental Mutation 'R0099:Mthfs'
ID33154
Institutional Source Beutler Lab
Gene Symbol Mthfs
Ensembl Gene ENSMUSG00000066442
Gene Name5, 10-methenyltetrahydrofolate synthetase
Synonyms2310020H23Rik, 1110034I12Rik
MMRRC Submission 038385-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0099 (G1)
Quality Score225
Status Validated (trace)
Chromosome9
Chromosomal Location89210676-89377713 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 89226163 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000085256] [ENSMUST00000118870]
Predicted Effect probably benign
Transcript: ENSMUST00000085256
SMART Domains Protein: ENSMUSP00000082354
Gene: ENSMUSG00000066442

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 10 198 4.2e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117314
SMART Domains Protein: ENSMUSP00000112854
Gene: ENSMUSG00000066442

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 1 141 1.6e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118870
SMART Domains Protein: ENSMUSP00000112695
Gene: ENSMUSG00000066442

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 10 128 1.2e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118887
SMART Domains Protein: ENSMUSP00000112390
Gene: ENSMUSG00000066442

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 1 70 2.1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127438
SMART Domains Protein: ENSMUSP00000122036
Gene: ENSMUSG00000066442

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 1 70 2.8e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127868
SMART Domains Protein: ENSMUSP00000118531
Gene: ENSMUSG00000066442

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 1 113 2.2e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149688
Predicted Effect probably benign
Transcript: ENSMUST00000185894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187362
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 100% (65/65)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality. Heterozygous mice display decreased de novo purine synthesis and reduced plasma folate levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930018M24Rik C T 14: 50,896,722 probably benign Het
Acad10 A C 5: 121,621,290 D1043E probably damaging Het
Adamtsl4 C T 3: 95,684,139 G173R probably benign Het
Astn1 G T 1: 158,502,151 S192I probably damaging Het
Atg2a T A 19: 6,252,789 V1010E probably damaging Het
C130079G13Rik A C 3: 59,936,435 K183N probably benign Het
Col11a2 A G 17: 34,049,674 E311G probably damaging Het
Col4a3 A C 1: 82,717,993 E1638A probably benign Het
Cstf2t A G 19: 31,083,831 R256G probably benign Het
Cyp4a12a T C 4: 115,326,672 L225P probably damaging Het
Diexf A G 1: 193,128,470 L75P probably damaging Het
Dnah5 G A 15: 28,239,934 R479H probably damaging Het
Dsg3 A G 18: 20,540,022 I917V probably benign Het
Fam76a G T 4: 132,910,787 probably benign Het
Fras1 T A 5: 96,614,917 probably null Het
Gli1 A G 10: 127,336,006 V293A probably damaging Het
Gm10782 T A 13: 56,363,143 noncoding transcript Het
Greb1l A G 18: 10,509,158 E490G probably damaging Het
Hydin G A 8: 110,589,561 G4362R probably damaging Het
Ica1 A T 6: 8,749,778 probably benign Het
Ikzf4 T A 10: 128,634,197 I485F probably damaging Het
Irf5 A G 6: 29,533,967 T34A probably damaging Het
Krt81 A T 15: 101,463,521 C59* probably null Het
Kynu T A 2: 43,629,053 probably null Het
Ly6g6c T C 17: 35,068,915 V61A probably damaging Het
Manea A C 4: 26,328,104 I312M probably damaging Het
Micall1 G T 15: 79,131,901 probably benign Het
Myh4 A G 11: 67,259,347 T1877A probably benign Het
Myo3a T C 2: 22,245,598 I92T probably benign Het
Nepn A G 10: 52,401,085 S306G probably damaging Het
Nol8 T C 13: 49,672,689 V995A probably benign Het
Olfr1453 A G 19: 13,027,801 F176S probably damaging Het
Olfr1458 T A 19: 13,103,140 T49S probably benign Het
Olfr160 A T 9: 37,711,454 V275E probably damaging Het
Olfr967 A G 9: 39,750,661 I92V possibly damaging Het
Pde1a T A 2: 79,868,313 probably null Het
Phf14 A G 6: 11,987,697 probably benign Het
Plekhh2 C T 17: 84,591,672 Q1026* probably null Het
Polr2b T A 5: 77,320,950 probably benign Het
Ppp1r36 G T 12: 76,436,282 probably null Het
Prdm14 A T 1: 13,118,945 C392S probably damaging Het
Rabgap1l A G 1: 160,682,116 S436P possibly damaging Het
Rfc2 A T 5: 134,595,281 probably null Het
Rfx4 A T 10: 84,894,304 M437L probably benign Het
Rgs17 T A 10: 5,842,583 R74S probably benign Het
Rnf139 C A 15: 58,899,415 L430I probably damaging Het
Sgsm1 C A 5: 113,274,360 probably benign Het
Skint6 T A 4: 112,811,501 T1126S possibly damaging Het
Slc15a2 T C 16: 36,753,036 E602G probably damaging Het
Stpg2 T C 3: 139,243,193 probably benign Het
Sycp2l T C 13: 41,129,525 probably benign Het
Tlr11 A T 14: 50,360,818 N87I probably benign Het
Tril A G 6: 53,818,363 F625L probably damaging Het
Ube3c T A 5: 29,607,064 V434E probably damaging Het
Usp34 G A 11: 23,363,111 G533R probably damaging Het
Zfp93 G T 7: 24,275,475 R295L probably benign Het
Other mutations in Mthfs
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0090:Mthfs UTSW 9 89211291 missense probably damaging 1.00
R0837:Mthfs UTSW 9 89215390 missense probably damaging 1.00
R2047:Mthfs UTSW 9 89215303 missense probably damaging 1.00
R4796:Mthfs UTSW 9 89240025 missense probably benign 0.01
R6599:Mthfs UTSW 9 89239908 missense probably damaging 1.00
R8068:Mthfs UTSW 9 89211235 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTCCCCAGAGCTGTGATTAAAC -3'
(R):5'- ACTGAACTGCTGTCTGCACACC -3'

Sequencing Primer
(F):5'- agctgtgattaaacacatgcc -3'
(R):5'- TGAATCGTTTCCCACAGAGG -3'
Posted On2013-05-09