Incidental Mutation 'R4484:Gucy1b2'
ID331552
Institutional Source Beutler Lab
Gene Symbol Gucy1b2
Ensembl Gene ENSMUSG00000021933
Gene Nameguanylate cyclase 1, soluble, beta 2
Synonyms
MMRRC Submission 041740-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R4484 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location62392676-62456289 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 62411589 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 513 (I513F)
Ref Sequence ENSEMBL: ENSMUSP00000022501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022501] [ENSMUST00000165651]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022501
AA Change: I513F

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022501
Gene: ENSMUSG00000021933
AA Change: I513F

DomainStartEndE-ValueType
Pfam:HNOB 83 244 6e-60 PFAM
Blast:CYCc 263 362 3e-24 BLAST
PDB:4GJ4|D 350 471 4e-8 PDB
CYCc 513 712 1.11e-108 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000165651
AA Change: I498F

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128114
Gene: ENSMUSG00000021933
AA Change: I498F

DomainStartEndE-ValueType
Pfam:HNOB 82 250 1.1e-53 PFAM
Blast:CYCc 263 347 6e-25 BLAST
PDB:4GJ4|D 335 456 5e-8 PDB
CYCc 498 697 1.11e-108 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (46/47)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a normal hyperventilation response to a 10% oxygen environment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox4 T C 1: 58,262,571 C1101R probably damaging Het
Atp8b5 T C 4: 43,357,016 I588T probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
BC067074 A T 13: 113,319,199 N593I probably damaging Het
Cd164l2 T A 4: 133,223,675 V147E probably damaging Het
Celsr3 G A 9: 108,846,063 probably null Het
Cr2 T C 1: 195,154,174 T894A probably damaging Het
Crtc3 T C 7: 80,589,948 D552G probably damaging Het
Cyp2c50 A G 19: 40,090,639 E142G probably damaging Het
Dcstamp A G 15: 39,754,224 I10V probably benign Het
Fam208b T C 13: 3,581,831 D890G probably benign Het
Gm44501 T A 17: 40,576,616 F8L unknown Het
Gpr179 T C 11: 97,335,711 S1873G probably benign Het
Gprin2 C A 14: 34,194,797 A339S probably benign Het
Ighv5-6 T A 12: 113,625,588 R91* probably null Het
Igtp G A 11: 58,206,998 V332I possibly damaging Het
Itfg1 G A 8: 85,726,249 P497S probably damaging Het
Junb T C 8: 84,977,888 N181S possibly damaging Het
Lama3 T C 18: 12,481,088 Y1305H probably benign Het
Lrrcc1 A T 3: 14,551,443 N44I probably damaging Het
Med15 A T 16: 17,671,564 probably benign Het
Mkks T C 2: 136,880,574 E221G probably benign Het
Mtmr10 T C 7: 64,320,631 V374A possibly damaging Het
Muc5b G T 7: 141,868,450 C4441F possibly damaging Het
Nim1k G A 13: 119,712,174 Q395* probably null Het
Nlrp6 A G 7: 140,921,781 D87G probably damaging Het
Ntng1 C A 3: 110,143,808 probably benign Het
Padi1 G T 4: 140,817,270 probably benign Het
Rxrg T C 1: 167,625,027 S133P probably benign Het
Snx19 T C 9: 30,427,896 I110T probably benign Het
Strap T C 6: 137,749,336 probably benign Het
Tgtp2 A T 11: 49,059,352 M131K probably damaging Het
Tppp2 T C 14: 51,919,411 F82L probably damaging Het
Ttc39c A G 18: 12,730,069 K397E possibly damaging Het
Txlnb T TTA 10: 17,838,997 probably null Het
Usp36 T A 11: 118,285,795 R66W probably damaging Het
Vmn1r30 A T 6: 58,435,133 V238E probably damaging Het
Vmn1r6 A G 6: 57,003,189 I279V probably benign Het
Vmn2r61 G A 7: 42,300,696 D847N probably benign Het
Zfp622 G A 15: 25,987,051 probably null Het
Zfp963 T C 8: 69,744,485 I36V probably benign Het
Zfy2 A G Y: 2,107,351 Y428H possibly damaging Het
Other mutations in Gucy1b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Gucy1b2 APN 14 62406245 missense probably damaging 1.00
IGL00465:Gucy1b2 APN 14 62403200 missense probably benign
IGL00756:Gucy1b2 APN 14 62403209 missense probably benign
IGL01800:Gucy1b2 APN 14 62411655 missense probably benign 0.03
IGL01875:Gucy1b2 APN 14 62420146 missense probably damaging 1.00
IGL03033:Gucy1b2 APN 14 62415944 missense probably benign 0.00
IGL03110:Gucy1b2 APN 14 62433834 splice site probably benign
IGL02796:Gucy1b2 UTSW 14 62407694 missense probably benign 0.42
R0183:Gucy1b2 UTSW 14 62419140 missense probably damaging 1.00
R0605:Gucy1b2 UTSW 14 62403159 splice site probably benign
R0815:Gucy1b2 UTSW 14 62419062 missense probably benign 0.00
R0863:Gucy1b2 UTSW 14 62419062 missense probably benign 0.00
R0972:Gucy1b2 UTSW 14 62408678 missense possibly damaging 0.88
R0972:Gucy1b2 UTSW 14 62414369 missense possibly damaging 0.61
R1438:Gucy1b2 UTSW 14 62414321 missense probably damaging 0.98
R2011:Gucy1b2 UTSW 14 62408758 missense probably damaging 0.99
R2409:Gucy1b2 UTSW 14 62406179 frame shift probably null
R3692:Gucy1b2 UTSW 14 62404627 missense probably damaging 1.00
R4715:Gucy1b2 UTSW 14 62423017 missense possibly damaging 0.95
R4730:Gucy1b2 UTSW 14 62407759 missense probably damaging 1.00
R4812:Gucy1b2 UTSW 14 62415897 splice site probably null
R4839:Gucy1b2 UTSW 14 62448246 missense probably damaging 1.00
R5261:Gucy1b2 UTSW 14 62404579 missense probably damaging 1.00
R5326:Gucy1b2 UTSW 14 62453330 critical splice donor site probably null
R5656:Gucy1b2 UTSW 14 62422981 missense probably damaging 1.00
R5779:Gucy1b2 UTSW 14 62414301 missense possibly damaging 0.82
R6000:Gucy1b2 UTSW 14 62419050 missense probably benign 0.00
R6274:Gucy1b2 UTSW 14 62415939 missense probably damaging 1.00
R7457:Gucy1b2 UTSW 14 62392952 missense probably benign 0.08
R7487:Gucy1b2 UTSW 14 62448223 missense probably damaging 0.97
R7607:Gucy1b2 UTSW 14 62419177 missense probably damaging 1.00
RF030:Gucy1b2 UTSW 14 62408641 critical splice donor site probably benign
RF035:Gucy1b2 UTSW 14 62408641 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- TGTCCAGATCTGCCAAGGTTC -3'
(R):5'- ATGGAGTCTCTGAAGTGCATG -3'

Sequencing Primer
(F):5'- CAAAGTTTACACCACTTAGCGTGAG -3'
(R):5'- GTGTTCTCCAAAGCTCCGCAG -3'
Posted On2015-07-21