Incidental Mutation 'R4484:Med15'
List |< first << previous [record 22 of 43] next >> last >|
ID331556
Institutional Source Beutler Lab
Gene Symbol Med15
Ensembl Gene ENSMUSG00000012114
Gene Namemediator complex subunit 15
SynonymsPcqap, A230074L19Rik
MMRRC Submission 041740-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R4484 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location17651208-17732891 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 17671564 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156242 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012259] [ENSMUST00000080936] [ENSMUST00000231674] [ENSMUST00000232202] [ENSMUST00000232236] [ENSMUST00000232645]
Predicted Effect unknown
Transcript: ENSMUST00000012259
AA Change: M382K
SMART Domains Protein: ENSMUSP00000012259
Gene: ENSMUSG00000012114
AA Change: M382K

DomainStartEndE-ValueType
Pfam:Med15 17 789 N/A PFAM
Predicted Effect unknown
Transcript: ENSMUST00000080936
AA Change: M382K
SMART Domains Protein: ENSMUSP00000079737
Gene: ENSMUSG00000012114
AA Change: M382K

DomainStartEndE-ValueType
Pfam:Med15 17 749 1.2e-276 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231674
Predicted Effect probably benign
Transcript: ENSMUST00000232163
Predicted Effect probably benign
Transcript: ENSMUST00000232202
Predicted Effect unknown
Transcript: ENSMUST00000232236
AA Change: M382K
Predicted Effect probably benign
Transcript: ENSMUST00000232645
Meta Mutation Damage Score 0.0599 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox4 T C 1: 58,262,571 C1101R probably damaging Het
Atp8b5 T C 4: 43,357,016 I588T probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
BC067074 A T 13: 113,319,199 N593I probably damaging Het
Cd164l2 T A 4: 133,223,675 V147E probably damaging Het
Celsr3 G A 9: 108,846,063 probably null Het
Cr2 T C 1: 195,154,174 T894A probably damaging Het
Crtc3 T C 7: 80,589,948 D552G probably damaging Het
Cyp2c50 A G 19: 40,090,639 E142G probably damaging Het
Dcstamp A G 15: 39,754,224 I10V probably benign Het
Fam208b T C 13: 3,581,831 D890G probably benign Het
Gm44501 T A 17: 40,576,616 F8L unknown Het
Gpr179 T C 11: 97,335,711 S1873G probably benign Het
Gprin2 C A 14: 34,194,797 A339S probably benign Het
Gucy1b2 T A 14: 62,411,589 I513F possibly damaging Het
Ighv5-6 T A 12: 113,625,588 R91* probably null Het
Igtp G A 11: 58,206,998 V332I possibly damaging Het
Itfg1 G A 8: 85,726,249 P497S probably damaging Het
Junb T C 8: 84,977,888 N181S possibly damaging Het
Lama3 T C 18: 12,481,088 Y1305H probably benign Het
Lrrcc1 A T 3: 14,551,443 N44I probably damaging Het
Mkks T C 2: 136,880,574 E221G probably benign Het
Mtmr10 T C 7: 64,320,631 V374A possibly damaging Het
Muc5b G T 7: 141,868,450 C4441F possibly damaging Het
Nim1k G A 13: 119,712,174 Q395* probably null Het
Nlrp6 A G 7: 140,921,781 D87G probably damaging Het
Ntng1 C A 3: 110,143,808 probably benign Het
Padi1 G T 4: 140,817,270 probably benign Het
Rxrg T C 1: 167,625,027 S133P probably benign Het
Snx19 T C 9: 30,427,896 I110T probably benign Het
Strap T C 6: 137,749,336 probably benign Het
Tgtp2 A T 11: 49,059,352 M131K probably damaging Het
Tppp2 T C 14: 51,919,411 F82L probably damaging Het
Ttc39c A G 18: 12,730,069 K397E possibly damaging Het
Txlnb T TTA 10: 17,838,997 probably null Het
Usp36 T A 11: 118,285,795 R66W probably damaging Het
Vmn1r30 A T 6: 58,435,133 V238E probably damaging Het
Vmn1r6 A G 6: 57,003,189 I279V probably benign Het
Vmn2r61 G A 7: 42,300,696 D847N probably benign Het
Zfp622 G A 15: 25,987,051 probably null Het
Zfp963 T C 8: 69,744,485 I36V probably benign Het
Zfy2 A G Y: 2,107,351 Y428H possibly damaging Het
Other mutations in Med15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Med15 APN 16 17680726 missense probably damaging 0.96
IGL00780:Med15 APN 16 17653487 missense probably damaging 1.00
IGL02365:Med15 APN 16 17671606 intron probably benign
R0324:Med15 UTSW 16 17697612 missense probably damaging 0.98
R1225:Med15 UTSW 16 17722788 missense probably damaging 1.00
R1695:Med15 UTSW 16 17722780 missense probably damaging 0.96
R1745:Med15 UTSW 16 17655706 unclassified probably benign
R1801:Med15 UTSW 16 17680735 missense possibly damaging 0.66
R1838:Med15 UTSW 16 17653562 missense probably benign 0.11
R1901:Med15 UTSW 16 17673154 unclassified probably benign
R2153:Med15 UTSW 16 17685451 critical splice donor site probably null
R2974:Med15 UTSW 16 17652711 missense probably damaging 1.00
R3808:Med15 UTSW 16 17655734 unclassified probably benign
R3809:Med15 UTSW 16 17655734 unclassified probably benign
R4240:Med15 UTSW 16 17655494 missense probably damaging 1.00
R4483:Med15 UTSW 16 17671564 intron probably benign
R4577:Med15 UTSW 16 17674515 nonsense probably null
R5652:Med15 UTSW 16 17655191 missense probably damaging 1.00
R6244:Med15 UTSW 16 17652745 nonsense probably null
R6701:Med15 UTSW 16 17671583 intron probably benign
R6793:Med15 UTSW 16 17652703 unclassified probably benign
R7036:Med15 UTSW 16 17698155 start codon destroyed probably null
R7038:Med15 UTSW 16 17652727 missense possibly damaging 0.90
R7211:Med15 UTSW 16 17698113 missense unknown
R7317:Med15 UTSW 16 17671643 missense unknown
R7390:Med15 UTSW 16 17722762 missense unknown
R7471:Med15 UTSW 16 17722865 missense probably benign 0.03
R7726:Med15 UTSW 16 17655174 missense possibly damaging 0.87
Z1177:Med15 UTSW 16 17653232 missense not run
Predicted Primers PCR Primer
(F):5'- AAAGCATCTTCCTCCAAGTGC -3'
(R):5'- AGTGAGTGCTCTGCTCTCTG -3'

Sequencing Primer
(F):5'- CTTCCTCCAAGTGCTATAATGTAGG -3'
(R):5'- CTCTCTGTGCAGATGGTTCCAAG -3'
Posted On2015-07-21