Incidental Mutation 'R4484:Gm44501'
List |< first << previous [record 12 of 43] next >> last >|
ID331557
Institutional Source Beutler Lab
Gene Symbol Gm44501
Ensembl Gene ENSMUSG00000090897
Gene Namepredicted readthrough transcript, 44501
SynonymsEsp6Esp5
MMRRC Submission 041740-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R4484 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location40561507-40579549 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40576616 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 8 (F8L)
Ref Sequence ENSEMBL: ENSMUSP00000128205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167713]
Predicted Effect unknown
Transcript: ENSMUST00000167713
AA Change: F8L
SMART Domains Protein: ENSMUSP00000128205
Gene: ENSMUSG00000090897
AA Change: F8L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ESP 24 84 2e-24 PFAM
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: This locus represents naturally occurring readthrough transcription between the neighboring Esp6 (exocrine gland secreted peptide 6) and Esp5 (exocrine gland secreted peptide 5) genes on chromosome 17. The readthrough transcript encodes a protein that shares sequence identity with the downstream gene product, but is shorter at its N-terminus. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox4 T C 1: 58,262,571 C1101R probably damaging Het
Atp8b5 T C 4: 43,357,016 I588T probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
BC067074 A T 13: 113,319,199 N593I probably damaging Het
Cd164l2 T A 4: 133,223,675 V147E probably damaging Het
Celsr3 G A 9: 108,846,063 probably null Het
Cr2 T C 1: 195,154,174 T894A probably damaging Het
Crtc3 T C 7: 80,589,948 D552G probably damaging Het
Cyp2c50 A G 19: 40,090,639 E142G probably damaging Het
Dcstamp A G 15: 39,754,224 I10V probably benign Het
Fam208b T C 13: 3,581,831 D890G probably benign Het
Gpr179 T C 11: 97,335,711 S1873G probably benign Het
Gprin2 C A 14: 34,194,797 A339S probably benign Het
Gucy1b2 T A 14: 62,411,589 I513F possibly damaging Het
Ighv5-6 T A 12: 113,625,588 R91* probably null Het
Igtp G A 11: 58,206,998 V332I possibly damaging Het
Itfg1 G A 8: 85,726,249 P497S probably damaging Het
Junb T C 8: 84,977,888 N181S possibly damaging Het
Lama3 T C 18: 12,481,088 Y1305H probably benign Het
Lrrcc1 A T 3: 14,551,443 N44I probably damaging Het
Med15 A T 16: 17,671,564 probably benign Het
Mkks T C 2: 136,880,574 E221G probably benign Het
Mtmr10 T C 7: 64,320,631 V374A possibly damaging Het
Muc5b G T 7: 141,868,450 C4441F possibly damaging Het
Nim1k G A 13: 119,712,174 Q395* probably null Het
Nlrp6 A G 7: 140,921,781 D87G probably damaging Het
Ntng1 C A 3: 110,143,808 probably benign Het
Padi1 G T 4: 140,817,270 probably benign Het
Rxrg T C 1: 167,625,027 S133P probably benign Het
Snx19 T C 9: 30,427,896 I110T probably benign Het
Strap T C 6: 137,749,336 probably benign Het
Tgtp2 A T 11: 49,059,352 M131K probably damaging Het
Tppp2 T C 14: 51,919,411 F82L probably damaging Het
Ttc39c A G 18: 12,730,069 K397E possibly damaging Het
Txlnb T TTA 10: 17,838,997 probably null Het
Usp36 T A 11: 118,285,795 R66W probably damaging Het
Vmn1r30 A T 6: 58,435,133 V238E probably damaging Het
Vmn1r6 A G 6: 57,003,189 I279V probably benign Het
Vmn2r61 G A 7: 42,300,696 D847N probably benign Het
Zfp622 G A 15: 25,987,051 probably null Het
Zfp963 T C 8: 69,744,485 I36V probably benign Het
Zfy2 A G Y: 2,107,351 Y428H possibly damaging Het
Other mutations in Gm44501
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0141:Gm44501 UTSW 17 40578853 missense probably benign 0.01
R2420:Gm44501 UTSW 17 40578709 missense possibly damaging 0.93
R3727:Gm44501 UTSW 17 40576615 missense unknown
R4735:Gm44501 UTSW 17 40578919 missense probably benign 0.00
R4795:Gm44501 UTSW 17 40578714 missense probably benign 0.01
R4888:Gm44501 UTSW 17 40576624 missense unknown
R4904:Gm44501 UTSW 17 40578993 missense possibly damaging 0.46
R5057:Gm44501 UTSW 17 40578672 missense probably benign 0.00
R7429:Gm44501 UTSW 17 40576626 missense probably null
R7746:Gm44501 UTSW 17 40578829 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GCAAGGTTATCAGTCAAGTGC -3'
(R):5'- TAGCCCTGTTATATGCTCCAAG -3'

Sequencing Primer
(F):5'- CAAGGTTATCAGTCAAGTGCTTTAGG -3'
(R):5'- GCTCCAAGACACAAATGAGAATATTG -3'
Posted On2015-07-21