Incidental Mutation 'R4484:Ttc39c'
List |< first << previous [record 35 of 43] next >> last >|
ID331559
Institutional Source Beutler Lab
Gene Symbol Ttc39c
Ensembl Gene ENSMUSG00000024424
Gene Nametetratricopeptide repeat domain 39C
Synonyms
MMRRC Submission 041740-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R4484 (G1)
Quality Score215
Status Validated
Chromosome18
Chromosomal Location12599926-12737050 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12730069 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 397 (K397E)
Ref Sequence ENSEMBL: ENSMUSP00000133127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025294] [ENSMUST00000169401]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025294
AA Change: K455E

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025294
Gene: ENSMUSG00000024424
AA Change: K455E

DomainStartEndE-ValueType
Pfam:DUF3808 31 495 7.3e-140 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143388
Predicted Effect possibly damaging
Transcript: ENSMUST00000169401
AA Change: K397E

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133127
Gene: ENSMUSG00000024424
AA Change: K397E

DomainStartEndE-ValueType
Pfam:DUF3808 1 437 1.6e-134 PFAM
Meta Mutation Damage Score 0.7282 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox4 T C 1: 58,262,571 C1101R probably damaging Het
Atp8b5 T C 4: 43,357,016 I588T probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
BC067074 A T 13: 113,319,199 N593I probably damaging Het
Cd164l2 T A 4: 133,223,675 V147E probably damaging Het
Celsr3 G A 9: 108,846,063 probably null Het
Cr2 T C 1: 195,154,174 T894A probably damaging Het
Crtc3 T C 7: 80,589,948 D552G probably damaging Het
Cyp2c50 A G 19: 40,090,639 E142G probably damaging Het
Dcstamp A G 15: 39,754,224 I10V probably benign Het
Fam208b T C 13: 3,581,831 D890G probably benign Het
Gm44501 T A 17: 40,576,616 F8L unknown Het
Gpr179 T C 11: 97,335,711 S1873G probably benign Het
Gprin2 C A 14: 34,194,797 A339S probably benign Het
Gucy1b2 T A 14: 62,411,589 I513F possibly damaging Het
Ighv5-6 T A 12: 113,625,588 R91* probably null Het
Igtp G A 11: 58,206,998 V332I possibly damaging Het
Itfg1 G A 8: 85,726,249 P497S probably damaging Het
Junb T C 8: 84,977,888 N181S possibly damaging Het
Lama3 T C 18: 12,481,088 Y1305H probably benign Het
Lrrcc1 A T 3: 14,551,443 N44I probably damaging Het
Med15 A T 16: 17,671,564 probably benign Het
Mkks T C 2: 136,880,574 E221G probably benign Het
Mtmr10 T C 7: 64,320,631 V374A possibly damaging Het
Muc5b G T 7: 141,868,450 C4441F possibly damaging Het
Nim1k G A 13: 119,712,174 Q395* probably null Het
Nlrp6 A G 7: 140,921,781 D87G probably damaging Het
Ntng1 C A 3: 110,143,808 probably benign Het
Padi1 G T 4: 140,817,270 probably benign Het
Rxrg T C 1: 167,625,027 S133P probably benign Het
Snx19 T C 9: 30,427,896 I110T probably benign Het
Strap T C 6: 137,749,336 probably benign Het
Tgtp2 A T 11: 49,059,352 M131K probably damaging Het
Tppp2 T C 14: 51,919,411 F82L probably damaging Het
Txlnb T TTA 10: 17,838,997 probably null Het
Usp36 T A 11: 118,285,795 R66W probably damaging Het
Vmn1r30 A T 6: 58,435,133 V238E probably damaging Het
Vmn1r6 A G 6: 57,003,189 I279V probably benign Het
Vmn2r61 G A 7: 42,300,696 D847N probably benign Het
Zfp622 G A 15: 25,987,051 probably null Het
Zfp963 T C 8: 69,744,485 I36V probably benign Het
Zfy2 A G Y: 2,107,351 Y428H possibly damaging Het
Other mutations in Ttc39c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:Ttc39c APN 18 12684895 splice site probably benign
IGL02323:Ttc39c APN 18 12736743 missense probably null 0.79
R1628:Ttc39c UTSW 18 12734879 splice site probably benign
R1771:Ttc39c UTSW 18 12684824 splice site probably null
R2002:Ttc39c UTSW 18 12697878 splice site probably null
R4162:Ttc39c UTSW 18 12724937 critical splice acceptor site probably null
R4344:Ttc39c UTSW 18 12728610 splice site probably null
R4752:Ttc39c UTSW 18 12728725 missense probably benign 0.05
R4872:Ttc39c UTSW 18 12687116 intron probably benign
R4912:Ttc39c UTSW 18 12734894 missense probably benign 0.00
R4946:Ttc39c UTSW 18 12724942 nonsense probably null
R5036:Ttc39c UTSW 18 12687081 critical splice donor site probably null
R5439:Ttc39c UTSW 18 12695371 missense possibly damaging 0.88
R5726:Ttc39c UTSW 18 12697935 missense probably damaging 1.00
R7213:Ttc39c UTSW 18 12687081 critical splice donor site probably null
R7400:Ttc39c UTSW 18 12643799 intron probably benign
R7413:Ttc39c UTSW 18 12728689 missense possibly damaging 0.65
R7567:Ttc39c UTSW 18 12689879 missense probably benign 0.01
Z1088:Ttc39c UTSW 18 12686963 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TTGACCTTGCACTGTGACTTG -3'
(R):5'- AAATGGTGCCAGGTCTAGCAAG -3'

Sequencing Primer
(F):5'- TGACTTGTCCCCAAAGTGCAG -3'
(R):5'- GTCTCGAAGCCTATGCCAATG -3'
Posted On2015-07-21