Incidental Mutation 'R4484:Cyp2c50'
ID331560
Institutional Source Beutler Lab
Gene Symbol Cyp2c50
Ensembl Gene ENSMUSG00000054827
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 50
Synonyms
MMRRC Submission 041740-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R4484 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location40089688-40113950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40090639 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 142 (E142G)
Ref Sequence ENSEMBL: ENSMUSP00000079065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068094] [ENSMUST00000080171]
Predicted Effect probably damaging
Transcript: ENSMUST00000068094
AA Change: E142G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068039
Gene: ENSMUSG00000054827
AA Change: E142G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 225 3.7e-54 PFAM
Pfam:p450 213 428 6.8e-88 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000080171
AA Change: E142G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079065
Gene: ENSMUSG00000054827
AA Change: E142G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 1.2e-162 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124391
Meta Mutation Damage Score 0.8242 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox4 T C 1: 58,262,571 C1101R probably damaging Het
Atp8b5 T C 4: 43,357,016 I588T probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
BC067074 A T 13: 113,319,199 N593I probably damaging Het
Cd164l2 T A 4: 133,223,675 V147E probably damaging Het
Celsr3 G A 9: 108,846,063 probably null Het
Cr2 T C 1: 195,154,174 T894A probably damaging Het
Crtc3 T C 7: 80,589,948 D552G probably damaging Het
Dcstamp A G 15: 39,754,224 I10V probably benign Het
Fam208b T C 13: 3,581,831 D890G probably benign Het
Gm44501 T A 17: 40,576,616 F8L unknown Het
Gpr179 T C 11: 97,335,711 S1873G probably benign Het
Gprin2 C A 14: 34,194,797 A339S probably benign Het
Gucy1b2 T A 14: 62,411,589 I513F possibly damaging Het
Ighv5-6 T A 12: 113,625,588 R91* probably null Het
Igtp G A 11: 58,206,998 V332I possibly damaging Het
Itfg1 G A 8: 85,726,249 P497S probably damaging Het
Junb T C 8: 84,977,888 N181S possibly damaging Het
Lama3 T C 18: 12,481,088 Y1305H probably benign Het
Lrrcc1 A T 3: 14,551,443 N44I probably damaging Het
Med15 A T 16: 17,671,564 probably benign Het
Mkks T C 2: 136,880,574 E221G probably benign Het
Mtmr10 T C 7: 64,320,631 V374A possibly damaging Het
Muc5b G T 7: 141,868,450 C4441F possibly damaging Het
Nim1k G A 13: 119,712,174 Q395* probably null Het
Nlrp6 A G 7: 140,921,781 D87G probably damaging Het
Ntng1 C A 3: 110,143,808 probably benign Het
Padi1 G T 4: 140,817,270 probably benign Het
Rxrg T C 1: 167,625,027 S133P probably benign Het
Snx19 T C 9: 30,427,896 I110T probably benign Het
Strap T C 6: 137,749,336 probably benign Het
Tgtp2 A T 11: 49,059,352 M131K probably damaging Het
Tppp2 T C 14: 51,919,411 F82L probably damaging Het
Ttc39c A G 18: 12,730,069 K397E possibly damaging Het
Txlnb T TTA 10: 17,838,997 probably null Het
Usp36 T A 11: 118,285,795 R66W probably damaging Het
Vmn1r30 A T 6: 58,435,133 V238E probably damaging Het
Vmn1r6 A G 6: 57,003,189 I279V probably benign Het
Vmn2r61 G A 7: 42,300,696 D847N probably benign Het
Zfp622 G A 15: 25,987,051 probably null Het
Zfp963 T C 8: 69,744,485 I36V probably benign Het
Zfy2 A G Y: 2,107,351 Y428H possibly damaging Het
Other mutations in Cyp2c50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01286:Cyp2c50 APN 19 40092284 missense probably benign 0.12
IGL01463:Cyp2c50 APN 19 40090978 missense probably damaging 1.00
IGL01669:Cyp2c50 APN 19 40098051 missense probably damaging 1.00
IGL02008:Cyp2c50 APN 19 40091099 nonsense probably null
IGL02331:Cyp2c50 APN 19 40090943 critical splice acceptor site probably null
IGL02830:Cyp2c50 APN 19 40098056 missense probably benign 0.00
R0115:Cyp2c50 UTSW 19 40092393 splice site probably benign
R1666:Cyp2c50 UTSW 19 40091055 missense probably benign
R1668:Cyp2c50 UTSW 19 40091055 missense probably benign
R1679:Cyp2c50 UTSW 19 40111415 missense possibly damaging 0.93
R2425:Cyp2c50 UTSW 19 40089848 missense probably benign 0.20
R2509:Cyp2c50 UTSW 19 40090569 missense probably benign
R2570:Cyp2c50 UTSW 19 40090320 missense probably benign 0.01
R3040:Cyp2c50 UTSW 19 40098126 missense probably benign 0.02
R3983:Cyp2c50 UTSW 19 40113518 missense possibly damaging 0.64
R4425:Cyp2c50 UTSW 19 40090692 missense possibly damaging 0.94
R4520:Cyp2c50 UTSW 19 40090689 missense probably benign 0.02
R4820:Cyp2c50 UTSW 19 40113580 missense probably damaging 1.00
R4978:Cyp2c50 UTSW 19 40098057 missense probably damaging 1.00
R5335:Cyp2c50 UTSW 19 40090616 missense probably benign 0.00
R5807:Cyp2c50 UTSW 19 40113500 missense probably damaging 1.00
R5955:Cyp2c50 UTSW 19 40090943 critical splice acceptor site probably null
R6553:Cyp2c50 UTSW 19 40090602 missense probably benign 0.41
R6560:Cyp2c50 UTSW 19 40096855 missense probably benign 0.03
R7241:Cyp2c50 UTSW 19 40090568 missense probably benign
R7389:Cyp2c50 UTSW 19 40090663 missense probably benign 0.01
R7511:Cyp2c50 UTSW 19 40092190 splice site probably null
RF008:Cyp2c50 UTSW 19 40089824 missense probably damaging 0.98
Z1088:Cyp2c50 UTSW 19 40097955 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- TGATTCTATGGCAGCCACCAG -3'
(R):5'- TGCCCTTGTTATCATGTTAAGACAC -3'

Sequencing Primer
(F):5'- TTCTATGGCAGCCACCAGACATC -3'
(R):5'- GGATTGGCCATTCACTGAAAC -3'
Posted On2015-07-21