Incidental Mutation 'R4484:Zfy2'
ID331561
Institutional Source Beutler Lab
Gene Symbol Zfy2
Ensembl Gene ENSMUSG00000000103
Gene Namezinc finger protein 2, Y-linked
SynonymsZfy-2
MMRRC Submission 041740-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R4484 (G1)
Quality Score222
Status Validated
ChromosomeY
Chromosomal Location2106015-2170409 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 2107351 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 428 (Y428H)
Ref Sequence ENSEMBL: ENSMUSP00000139591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115891] [ENSMUST00000187148]
Predicted Effect possibly damaging
Transcript: ENSMUST00000115891
AA Change: Y428H

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000111557
Gene: ENSMUSG00000000103
AA Change: Y428H

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:Zfx_Zfy_act 68 388 1.1e-115 PFAM
ZnF_C2H2 403 425 3.69e-4 SMART
ZnF_C2H2 434 456 1.26e-2 SMART
ZnF_C2H2 491 514 1.41e0 SMART
ZnF_C2H2 520 542 3.69e-4 SMART
ZnF_C2H2 548 571 3.63e-3 SMART
ZnF_C2H2 577 599 1.02e1 SMART
ZnF_C2H2 605 628 3.58e-2 SMART
ZnF_C2H2 634 656 2.95e-3 SMART
ZnF_C2H2 662 685 1.23e0 SMART
ZnF_C2H2 691 713 1.45e-2 SMART
ZnF_C2H2 719 742 1.2e-3 SMART
ZnF_C2H2 748 770 3.34e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000187148
AA Change: Y428H

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139591
Gene: ENSMUSG00000000103
AA Change: Y428H

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:Zfx_Zfy_act 67 388 2.6e-149 PFAM
ZnF_C2H2 403 425 3.69e-4 SMART
ZnF_C2H2 434 456 1.26e-2 SMART
ZnF_C2H2 491 514 1.41e0 SMART
ZnF_C2H2 520 542 3.69e-4 SMART
ZnF_C2H2 548 571 3.63e-3 SMART
ZnF_C2H2 577 599 1.02e1 SMART
ZnF_C2H2 605 628 3.58e-2 SMART
ZnF_C2H2 634 656 2.95e-3 SMART
ZnF_C2H2 662 685 1.23e0 SMART
ZnF_C2H2 691 713 1.45e-2 SMART
ZnF_C2H2 719 742 1.2e-3 SMART
ZnF_C2H2 748 770 3.34e-2 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox4 T C 1: 58,262,571 C1101R probably damaging Het
Atp8b5 T C 4: 43,357,016 I588T probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
BC067074 A T 13: 113,319,199 N593I probably damaging Het
Cd164l2 T A 4: 133,223,675 V147E probably damaging Het
Celsr3 G A 9: 108,846,063 probably null Het
Cr2 T C 1: 195,154,174 T894A probably damaging Het
Crtc3 T C 7: 80,589,948 D552G probably damaging Het
Cyp2c50 A G 19: 40,090,639 E142G probably damaging Het
Dcstamp A G 15: 39,754,224 I10V probably benign Het
Fam208b T C 13: 3,581,831 D890G probably benign Het
Gm44501 T A 17: 40,576,616 F8L unknown Het
Gpr179 T C 11: 97,335,711 S1873G probably benign Het
Gprin2 C A 14: 34,194,797 A339S probably benign Het
Gucy1b2 T A 14: 62,411,589 I513F possibly damaging Het
Ighv5-6 T A 12: 113,625,588 R91* probably null Het
Igtp G A 11: 58,206,998 V332I possibly damaging Het
Itfg1 G A 8: 85,726,249 P497S probably damaging Het
Junb T C 8: 84,977,888 N181S possibly damaging Het
Lama3 T C 18: 12,481,088 Y1305H probably benign Het
Lrrcc1 A T 3: 14,551,443 N44I probably damaging Het
Med15 A T 16: 17,671,564 probably benign Het
Mkks T C 2: 136,880,574 E221G probably benign Het
Mtmr10 T C 7: 64,320,631 V374A possibly damaging Het
Muc5b G T 7: 141,868,450 C4441F possibly damaging Het
Nim1k G A 13: 119,712,174 Q395* probably null Het
Nlrp6 A G 7: 140,921,781 D87G probably damaging Het
Ntng1 C A 3: 110,143,808 probably benign Het
Padi1 G T 4: 140,817,270 probably benign Het
Rxrg T C 1: 167,625,027 S133P probably benign Het
Snx19 T C 9: 30,427,896 I110T probably benign Het
Strap T C 6: 137,749,336 probably benign Het
Tgtp2 A T 11: 49,059,352 M131K probably damaging Het
Tppp2 T C 14: 51,919,411 F82L probably damaging Het
Ttc39c A G 18: 12,730,069 K397E possibly damaging Het
Txlnb T TTA 10: 17,838,997 probably null Het
Usp36 T A 11: 118,285,795 R66W probably damaging Het
Vmn1r30 A T 6: 58,435,133 V238E probably damaging Het
Vmn1r6 A G 6: 57,003,189 I279V probably benign Het
Vmn2r61 G A 7: 42,300,696 D847N probably benign Het
Zfp622 G A 15: 25,987,051 probably null Het
Zfp963 T C 8: 69,744,485 I36V probably benign Het
Other mutations in Zfy2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02850:Zfy2 APN Y 2106894 missense probably benign 0.01
IGL02850:Zfy2 APN Y 2117188 missense probably benign 0.00
IGL02851:Zfy2 APN Y 2106894 missense probably benign 0.01
IGL02851:Zfy2 APN Y 2117188 missense probably benign 0.00
IGL02852:Zfy2 APN Y 2106894 missense probably benign 0.01
IGL02852:Zfy2 APN Y 2117188 missense probably benign 0.00
PIT4515001:Zfy2 UTSW Y 2117096 missense probably benign 0.09
R0426:Zfy2 UTSW Y 2107348 missense possibly damaging 0.61
R0490:Zfy2 UTSW Y 2106620 missense possibly damaging 0.89
R1080:Zfy2 UTSW Y 2121645 missense probably benign 0.00
R1513:Zfy2 UTSW Y 2116185 missense probably benign 0.00
R1935:Zfy2 UTSW Y 2121496 missense probably benign 0.02
R1936:Zfy2 UTSW Y 2121496 missense probably benign 0.02
R2358:Zfy2 UTSW Y 2107272 missense possibly damaging 0.61
R4754:Zfy2 UTSW Y 2121477 missense probably benign 0.02
R4777:Zfy2 UTSW Y 2116194 missense probably benign 0.00
R4812:Zfy2 UTSW Y 2106334 missense probably benign 0.08
R5045:Zfy2 UTSW Y 2107159 missense possibly damaging 0.77
R5363:Zfy2 UTSW Y 2106555 missense possibly damaging 0.95
R6256:Zfy2 UTSW Y 2116267 missense probably benign 0.02
R6618:Zfy2 UTSW Y 2121477 missense probably benign 0.10
R6941:Zfy2 UTSW Y 2121491 missense probably benign 0.02
R7011:Zfy2 UTSW Y 2107127 missense possibly damaging 0.59
R7712:Zfy2 UTSW Y 2121420 missense probably benign 0.05
R7759:Zfy2 UTSW Y 2117083 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTGTATGCATTGTCCCAGCATG -3'
(R):5'- AGCATAGTGGATCAGGTTCTTTTC -3'

Sequencing Primer
(F):5'- TGTCCCAGCATGAGAAAGATTCTTCC -3'
(R):5'- GTTGCTCCTGATGGACAAA -3'
Posted On2015-07-21