Incidental Mutation 'R4485:Plat'
ID331578
Institutional Source Beutler Lab
Gene Symbol Plat
Ensembl Gene ENSMUSG00000031538
Gene Nameplasminogen activator, tissue
Synonymst-PA, D8Ertd2e, tPA
MMRRC Submission 041741-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4485 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location22757727-22782844 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 22772212 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 84 (S84N)
Ref Sequence ENSEMBL: ENSMUSP00000033941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033941]
Predicted Effect probably benign
Transcript: ENSMUST00000033941
AA Change: S84N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000033941
Gene: ENSMUSG00000031538
AA Change: S84N

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
FN1 38 80 5.69e-15 SMART
EGF 82 117 4.92e-5 SMART
KR 122 207 3.77e-33 SMART
KR 211 296 4.39e-34 SMART
Tryp_SPc 308 553 6.59e-84 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210960
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a key enzyme of the fibrinolytic pathway. The encoded protein undergoes proteolytic processing by plasmin to generate a heterodimeric serine protease that cleaves the proenzyme plasminogen to produce plasmin, a protease that is required to break down fibrin clots. Additionally, the encoded protein is involved in other biological processes such as synaptic plasticity, cell migration and tissue remodeling. Mice lacking the encoded protein display a reduction in long-term potentiation in hippocampus and conversely, transgenic mice overexpressing the encoded protein have increased and prolonged long-term potentiation. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal behavior, CNS synpatic transmission, and response to injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agxt2 A T 15: 10,378,882 I190L possibly damaging Het
Ahnak2 A G 12: 112,779,767 probably benign Het
Apol7b C A 15: 77,423,666 V210L probably benign Het
Banf2 C T 2: 144,073,852 T71M probably damaging Het
Cacna1s A G 1: 136,076,852 D130G probably damaging Het
Capn8 T C 1: 182,598,741 F214L possibly damaging Het
Ccdc129 A G 6: 55,887,066 T126A probably benign Het
Cdk5rap2 A T 4: 70,239,283 probably null Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cpb1 T G 3: 20,249,701 M400L probably benign Het
Eps15l1 A T 8: 72,399,687 I52N possibly damaging Het
Gbp9 C G 5: 105,083,808 G304A probably damaging Het
Gm14226 G A 2: 155,025,271 V383I probably benign Het
Gm8251 A G 1: 44,060,123 L605S probably benign Het
Npm2 A T 14: 70,648,309 V152D possibly damaging Het
Nsd1 T C 13: 55,245,621 V345A probably benign Het
Olfr1461 T C 19: 13,165,491 V159A possibly damaging Het
Olfr1474 T C 19: 13,471,555 I195T probably benign Het
Olfr482 T C 7: 108,095,015 D185G probably benign Het
Olfr679 T A 7: 105,086,601 V295D probably damaging Het
Otof T A 5: 30,375,000 H1601L possibly damaging Het
Prss30 T C 17: 23,973,156 D224G probably damaging Het
Psg25 C A 7: 18,526,278 V232F probably damaging Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Pus7l G T 15: 94,523,490 H646Q probably benign Het
Ryr1 C T 7: 29,090,156 S1511N probably damaging Het
Slc16a1 A G 3: 104,655,478 K413R probably benign Het
Snrnp48 T A 13: 38,216,328 M137K probably benign Het
Tecta T A 9: 42,337,274 H1944L possibly damaging Het
Tmem145 A G 7: 25,307,162 E65G possibly damaging Het
Vmn2r87 A T 10: 130,479,809 Y129* probably null Het
Wdr7 A G 18: 63,777,550 H671R possibly damaging Het
Zfp219 A G 14: 52,007,384 V518A probably damaging Het
Zfp472 T C 17: 32,977,568 W206R possibly damaging Het
Other mutations in Plat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Plat APN 8 22776828 missense probably benign 0.00
IGL01918:Plat APN 8 22780437 missense possibly damaging 0.82
IGL01998:Plat APN 8 22767147 missense probably benign 0.31
IGL02978:Plat APN 8 22776819 missense probably damaging 1.00
R0829:Plat UTSW 8 22772257 missense probably damaging 1.00
R1065:Plat UTSW 8 22776863 missense probably damaging 0.99
R2316:Plat UTSW 8 22776865 missense probably benign 0.04
R4873:Plat UTSW 8 22768450 missense probably benign 0.03
R4875:Plat UTSW 8 22768450 missense probably benign 0.03
R4924:Plat UTSW 8 22778253 missense probably damaging 1.00
R5051:Plat UTSW 8 22773672 missense probably benign 0.01
R5062:Plat UTSW 8 22772311 missense probably benign 0.19
R5402:Plat UTSW 8 22772722 missense probably damaging 1.00
R5672:Plat UTSW 8 22773648 missense probably benign 0.40
R6306:Plat UTSW 8 22772266 missense possibly damaging 0.83
R7035:Plat UTSW 8 22772311 missense probably benign 0.32
R7154:Plat UTSW 8 22778505 missense possibly damaging 0.76
R7297:Plat UTSW 8 22775697 missense probably benign 0.12
R7432:Plat UTSW 8 22773651 missense probably damaging 0.99
R7514:Plat UTSW 8 22775642 missense probably damaging 1.00
R7679:Plat UTSW 8 22772232 missense probably damaging 1.00
R7680:Plat UTSW 8 22772232 missense probably damaging 1.00
R7742:Plat UTSW 8 22772232 missense probably damaging 1.00
R7834:Plat UTSW 8 22772232 missense probably damaging 1.00
R7885:Plat UTSW 8 22771720 missense probably benign 0.00
R7918:Plat UTSW 8 22773639 missense probably damaging 1.00
R8039:Plat UTSW 8 22772232 missense probably damaging 1.00
R8040:Plat UTSW 8 22772232 missense probably damaging 1.00
R8243:Plat UTSW 8 22772232 missense probably damaging 1.00
R8347:Plat UTSW 8 22772232 missense probably damaging 1.00
R8355:Plat UTSW 8 22771742 nonsense probably null
R8422:Plat UTSW 8 22772232 missense probably damaging 1.00
R8423:Plat UTSW 8 22772232 missense probably damaging 1.00
R8424:Plat UTSW 8 22772232 missense probably damaging 1.00
R8426:Plat UTSW 8 22772232 missense probably damaging 1.00
R8427:Plat UTSW 8 22772232 missense probably damaging 1.00
R8485:Plat UTSW 8 22772232 missense probably damaging 1.00
R8507:Plat UTSW 8 22772232 missense probably damaging 1.00
R8510:Plat UTSW 8 22772232 missense probably damaging 1.00
R8714:Plat UTSW 8 22772232 missense probably damaging 1.00
R8716:Plat UTSW 8 22772232 missense probably damaging 1.00
R8717:Plat UTSW 8 22772232 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACTTTCCATGCTTCGCGG -3'
(R):5'- GTCTCTAAATGACCTCAGCTCC -3'

Sequencing Primer
(F):5'- CATGCTTCGCGGTTGACAG -3'
(R):5'- AGCTCCCCTTCTGTGGG -3'
Posted On2015-07-21