Incidental Mutation 'R0099:Gli1'
ID33158
Institutional Source Beutler Lab
Gene Symbol Gli1
Ensembl Gene ENSMUSG00000025407
Gene NameGLI-Kruppel family member GLI1
SynonymsZfp-5, Zfp5
MMRRC Submission 038385-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0099 (G1)
Quality Score175
Status Validated (trace)
Chromosome10
Chromosomal Location127329882-127341974 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127336006 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 293 (V293A)
Ref Sequence ENSEMBL: ENSMUSP00000026474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026474] [ENSMUST00000218236] [ENSMUST00000219671]
Predicted Effect probably damaging
Transcript: ENSMUST00000026474
AA Change: V293A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026474
Gene: ENSMUSG00000025407
AA Change: V293A

DomainStartEndE-ValueType
low complexity region 222 237 N/A INTRINSIC
ZnF_C2H2 238 263 1.33e-1 SMART
ZnF_C2H2 271 298 5.72e-1 SMART
ZnF_C2H2 304 328 2.57e-3 SMART
ZnF_C2H2 334 359 1.92e-2 SMART
ZnF_C2H2 365 390 2.61e-4 SMART
low complexity region 419 431 N/A INTRINSIC
low complexity region 540 562 N/A INTRINSIC
low complexity region 639 655 N/A INTRINSIC
low complexity region 748 759 N/A INTRINSIC
low complexity region 850 873 N/A INTRINSIC
low complexity region 941 962 N/A INTRINSIC
low complexity region 985 1002 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218236
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219640
Predicted Effect probably benign
Transcript: ENSMUST00000219671
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219808
Meta Mutation Damage Score 0.1383 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Kruppel family of zinc finger proteins. The encoded transcription factor is activated by the sonic hedgehog signal transduction cascade and regulates stem cell proliferation. The activity and nuclear localization of this protein is negatively regulated by p53 in an inhibitory loop. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygotes for a targeted null mutation are apparently normal, but homozygotes that are also heterozygous for a Gli2 knockout die soon after birth with multiple defects, while Gli2 knockout heterozygotes are normally viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930018M24Rik C T 14: 50,896,722 probably benign Het
Acad10 A C 5: 121,621,290 D1043E probably damaging Het
Adamtsl4 C T 3: 95,684,139 G173R probably benign Het
Astn1 G T 1: 158,502,151 S192I probably damaging Het
Atg2a T A 19: 6,252,789 V1010E probably damaging Het
C130079G13Rik A C 3: 59,936,435 K183N probably benign Het
Col11a2 A G 17: 34,049,674 E311G probably damaging Het
Col4a3 A C 1: 82,717,993 E1638A probably benign Het
Cstf2t A G 19: 31,083,831 R256G probably benign Het
Cyp4a12a T C 4: 115,326,672 L225P probably damaging Het
Diexf A G 1: 193,128,470 L75P probably damaging Het
Dnah5 G A 15: 28,239,934 R479H probably damaging Het
Dsg3 A G 18: 20,540,022 I917V probably benign Het
Fam76a G T 4: 132,910,787 probably benign Het
Fras1 T A 5: 96,614,917 probably null Het
Gm10782 T A 13: 56,363,143 noncoding transcript Het
Greb1l A G 18: 10,509,158 E490G probably damaging Het
Hydin G A 8: 110,589,561 G4362R probably damaging Het
Ica1 A T 6: 8,749,778 probably benign Het
Ikzf4 T A 10: 128,634,197 I485F probably damaging Het
Irf5 A G 6: 29,533,967 T34A probably damaging Het
Krt81 A T 15: 101,463,521 C59* probably null Het
Kynu T A 2: 43,629,053 probably null Het
Ly6g6c T C 17: 35,068,915 V61A probably damaging Het
Manea A C 4: 26,328,104 I312M probably damaging Het
Micall1 G T 15: 79,131,901 probably benign Het
Mthfs A T 9: 89,226,163 probably benign Het
Myh4 A G 11: 67,259,347 T1877A probably benign Het
Myo3a T C 2: 22,245,598 I92T probably benign Het
Nepn A G 10: 52,401,085 S306G probably damaging Het
Nol8 T C 13: 49,672,689 V995A probably benign Het
Olfr1453 A G 19: 13,027,801 F176S probably damaging Het
Olfr1458 T A 19: 13,103,140 T49S probably benign Het
Olfr160 A T 9: 37,711,454 V275E probably damaging Het
Olfr967 A G 9: 39,750,661 I92V possibly damaging Het
Pde1a T A 2: 79,868,313 probably null Het
Phf14 A G 6: 11,987,697 probably benign Het
Plekhh2 C T 17: 84,591,672 Q1026* probably null Het
Polr2b T A 5: 77,320,950 probably benign Het
Ppp1r36 G T 12: 76,436,282 probably null Het
Prdm14 A T 1: 13,118,945 C392S probably damaging Het
Rabgap1l A G 1: 160,682,116 S436P possibly damaging Het
Rfc2 A T 5: 134,595,281 probably null Het
Rfx4 A T 10: 84,894,304 M437L probably benign Het
Rgs17 T A 10: 5,842,583 R74S probably benign Het
Rnf139 C A 15: 58,899,415 L430I probably damaging Het
Sgsm1 C A 5: 113,274,360 probably benign Het
Skint6 T A 4: 112,811,501 T1126S possibly damaging Het
Slc15a2 T C 16: 36,753,036 E602G probably damaging Het
Stpg2 T C 3: 139,243,193 probably benign Het
Sycp2l T C 13: 41,129,525 probably benign Het
Tlr11 A T 14: 50,360,818 N87I probably benign Het
Tril A G 6: 53,818,363 F625L probably damaging Het
Ube3c T A 5: 29,607,064 V434E probably damaging Het
Usp34 G A 11: 23,363,111 G533R probably damaging Het
Zfp93 G T 7: 24,275,475 R295L probably benign Het
Other mutations in Gli1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01543:Gli1 APN 10 127332478 missense probably damaging 1.00
IGL01824:Gli1 APN 10 127336527 missense probably benign 0.44
IGL02134:Gli1 APN 10 127336500 missense probably benign 0.00
IGL02508:Gli1 APN 10 127337092 missense probably benign 0.14
IGL02931:Gli1 APN 10 127332410 missense probably benign 0.00
R0590:Gli1 UTSW 10 127331563 missense possibly damaging 0.82
R0792:Gli1 UTSW 10 127332577 missense probably damaging 0.99
R1169:Gli1 UTSW 10 127338451 missense probably damaging 1.00
R1519:Gli1 UTSW 10 127334269 missense possibly damaging 0.93
R1522:Gli1 UTSW 10 127332577 missense probably damaging 0.99
R1550:Gli1 UTSW 10 127338516 missense probably damaging 1.00
R1592:Gli1 UTSW 10 127331329 missense probably damaging 0.97
R1879:Gli1 UTSW 10 127333737 missense probably damaging 1.00
R1892:Gli1 UTSW 10 127330106 missense possibly damaging 0.82
R1934:Gli1 UTSW 10 127331239 missense possibly damaging 0.65
R2049:Gli1 UTSW 10 127336727 missense probably damaging 1.00
R2088:Gli1 UTSW 10 127331500 missense probably damaging 1.00
R2141:Gli1 UTSW 10 127336727 missense probably damaging 1.00
R3803:Gli1 UTSW 10 127338065 splice site probably benign
R3873:Gli1 UTSW 10 127331356 missense probably damaging 1.00
R3874:Gli1 UTSW 10 127330219 missense probably damaging 1.00
R3899:Gli1 UTSW 10 127336666 missense possibly damaging 0.64
R4703:Gli1 UTSW 10 127330855 missense possibly damaging 0.88
R5552:Gli1 UTSW 10 127330262 missense probably benign 0.00
R5686:Gli1 UTSW 10 127337436 missense probably benign 0.01
R5812:Gli1 UTSW 10 127337415 missense probably damaging 1.00
R6053:Gli1 UTSW 10 127334315 missense probably damaging 1.00
R7088:Gli1 UTSW 10 127335999 missense probably damaging 1.00
R7162:Gli1 UTSW 10 127332437 missense probably benign
Predicted Primers PCR Primer
(F):5'- aagccccaccccacaAAAATGC -3'
(R):5'- TCTGTGTATGAGACAGACTGCCGC -3'

Sequencing Primer
(F):5'- ccaccccacaAAAATGCAATATAAC -3'
(R):5'- ACTGAAGCCCAGAGTATCTTTGC -3'
Posted On2013-05-09