Incidental Mutation 'R4485:Ahnak2'
ID331583
Institutional Source Beutler Lab
Gene Symbol Ahnak2
Ensembl Gene ENSMUSG00000072812
Gene NameAHNAK nucleoprotein 2
SynonymsLOC382643
MMRRC Submission 041741-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4485 (G1)
Quality Score117
Status Not validated
Chromosome12
Chromosomal Location112772194-112802657 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 112779767 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101010] [ENSMUST00000124526] [ENSMUST00000128258]
Predicted Effect probably benign
Transcript: ENSMUST00000101010
SMART Domains Protein: ENSMUSP00000098572
Gene: ENSMUSG00000072812

DomainStartEndE-ValueType
low complexity region 5 14 N/A INTRINSIC
low complexity region 364 375 N/A INTRINSIC
low complexity region 545 564 N/A INTRINSIC
low complexity region 717 733 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124526
SMART Domains Protein: ENSMUSP00000114522
Gene: ENSMUSG00000072812

DomainStartEndE-ValueType
low complexity region 73 94 N/A INTRINSIC
PDZ 118 190 6e-4 SMART
low complexity region 268 281 N/A INTRINSIC
low complexity region 300 319 N/A INTRINSIC
low complexity region 405 429 N/A INTRINSIC
internal_repeat_1 465 898 2.74e-235 PROSPERO
low complexity region 905 923 N/A INTRINSIC
low complexity region 990 1013 N/A INTRINSIC
low complexity region 1076 1092 N/A INTRINSIC
internal_repeat_1 1145 1588 2.74e-235 PROSPERO
low complexity region 1590 1632 N/A INTRINSIC
low complexity region 1639 1700 N/A INTRINSIC
low complexity region 1709 1736 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128258
SMART Domains Protein: ENSMUSP00000122404
Gene: ENSMUSG00000072812

DomainStartEndE-ValueType
low complexity region 5 66 N/A INTRINSIC
internal_repeat_1 67 251 2.35e-83 PROSPERO
low complexity region 285 308 N/A INTRINSIC
low complexity region 371 389 N/A INTRINSIC
internal_repeat_1 413 597 2.35e-83 PROSPERO
low complexity region 734 756 N/A INTRINSIC
low complexity region 811 820 N/A INTRINSIC
low complexity region 1170 1181 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
low complexity region 1523 1539 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000137195
AA Change: V415A
SMART Domains Protein: ENSMUSP00000116582
Gene: ENSMUSG00000072812
AA Change: V415A

DomainStartEndE-ValueType
internal_repeat_1 2 521 3.81e-221 PROSPERO
low complexity region 557 569 N/A INTRINSIC
internal_repeat_1 606 1126 3.81e-221 PROSPERO
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agxt2 A T 15: 10,378,882 I190L possibly damaging Het
Apol7b C A 15: 77,423,666 V210L probably benign Het
Banf2 C T 2: 144,073,852 T71M probably damaging Het
Cacna1s A G 1: 136,076,852 D130G probably damaging Het
Capn8 T C 1: 182,598,741 F214L possibly damaging Het
Ccdc129 A G 6: 55,887,066 T126A probably benign Het
Cdk5rap2 A T 4: 70,239,283 probably null Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cpb1 T G 3: 20,249,701 M400L probably benign Het
Eps15l1 A T 8: 72,399,687 I52N possibly damaging Het
Gbp9 C G 5: 105,083,808 G304A probably damaging Het
Gm14226 G A 2: 155,025,271 V383I probably benign Het
Gm8251 A G 1: 44,060,123 L605S probably benign Het
Npm2 A T 14: 70,648,309 V152D possibly damaging Het
Nsd1 T C 13: 55,245,621 V345A probably benign Het
Olfr1461 T C 19: 13,165,491 V159A possibly damaging Het
Olfr1474 T C 19: 13,471,555 I195T probably benign Het
Olfr482 T C 7: 108,095,015 D185G probably benign Het
Olfr679 T A 7: 105,086,601 V295D probably damaging Het
Otof T A 5: 30,375,000 H1601L possibly damaging Het
Plat G A 8: 22,772,212 S84N probably benign Het
Prss30 T C 17: 23,973,156 D224G probably damaging Het
Psg25 C A 7: 18,526,278 V232F probably damaging Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Pus7l G T 15: 94,523,490 H646Q probably benign Het
Ryr1 C T 7: 29,090,156 S1511N probably damaging Het
Slc16a1 A G 3: 104,655,478 K413R probably benign Het
Snrnp48 T A 13: 38,216,328 M137K probably benign Het
Tecta T A 9: 42,337,274 H1944L possibly damaging Het
Tmem145 A G 7: 25,307,162 E65G possibly damaging Het
Vmn2r87 A T 10: 130,479,809 Y129* probably null Het
Wdr7 A G 18: 63,777,550 H671R possibly damaging Het
Zfp219 A G 14: 52,007,384 V518A probably damaging Het
Zfp472 T C 17: 32,977,568 W206R possibly damaging Het
Other mutations in Ahnak2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02257:Ahnak2 APN 12 112785285 missense possibly damaging 0.79
IGL02994:Ahnak2 APN 12 112786207 missense probably damaging 0.99
PIT4480001:Ahnak2 UTSW 12 112773924 missense possibly damaging 0.79
PIT4810001:Ahnak2 UTSW 12 112785594 missense
R0025:Ahnak2 UTSW 12 112785534 missense probably damaging 0.99
R0025:Ahnak2 UTSW 12 112785534 missense probably damaging 0.99
R0038:Ahnak2 UTSW 12 112774462 missense probably benign 0.00
R0125:Ahnak2 UTSW 12 112785156 missense probably benign 0.41
R1173:Ahnak2 UTSW 12 112785789 missense probably damaging 1.00
R1494:Ahnak2 UTSW 12 112787950 missense probably damaging 1.00
R1712:Ahnak2 UTSW 12 112785378 missense probably benign 0.05
R1888:Ahnak2 UTSW 12 112773891 missense possibly damaging 0.49
R1888:Ahnak2 UTSW 12 112773891 missense possibly damaging 0.49
R2042:Ahnak2 UTSW 12 112785819 missense probably damaging 0.98
R2056:Ahnak2 UTSW 12 112785006 missense probably benign 0.00
R2417:Ahnak2 UTSW 12 112775371 missense probably damaging 1.00
R2762:Ahnak2 UTSW 12 112785364 missense probably damaging 0.96
R3618:Ahnak2 UTSW 12 112786222 missense probably damaging 1.00
R3706:Ahnak2 UTSW 12 112773651 missense possibly damaging 0.74
R3739:Ahnak2 UTSW 12 112774558 missense probably benign 0.05
R3950:Ahnak2 UTSW 12 112785789 missense probably damaging 1.00
R4651:Ahnak2 UTSW 12 112774837 missense possibly damaging 0.93
R4652:Ahnak2 UTSW 12 112774837 missense possibly damaging 0.93
R4831:Ahnak2 UTSW 12 112775749 missense probably damaging 0.99
R4836:Ahnak2 UTSW 12 112774116 missense probably damaging 1.00
R4837:Ahnak2 UTSW 12 112785739 missense probably benign 0.00
R4864:Ahnak2 UTSW 12 112773606 missense probably damaging 0.98
R4908:Ahnak2 UTSW 12 112775272 missense probably benign 0.00
R5067:Ahnak2 UTSW 12 112785316 missense probably benign 0.01
R5146:Ahnak2 UTSW 12 112775726 missense probably benign 0.00
R5228:Ahnak2 UTSW 12 112775386 missense probably benign 0.03
R5255:Ahnak2 UTSW 12 112773378 missense possibly damaging 0.92
R5323:Ahnak2 UTSW 12 112779812 unclassified probably benign
R5523:Ahnak2 UTSW 12 112775208 missense probably damaging 1.00
R5733:Ahnak2 UTSW 12 112775666 nonsense probably null
R5799:Ahnak2 UTSW 12 112778930 unclassified probably benign
R5817:Ahnak2 UTSW 12 112774003 missense probably damaging 1.00
R5835:Ahnak2 UTSW 12 112775796 missense possibly damaging 0.66
R6083:Ahnak2 UTSW 12 112782612 missense probably benign 0.06
R6083:Ahnak2 UTSW 12 112782999 missense probably benign 0.01
R6167:Ahnak2 UTSW 12 112783122 missense probably benign 0.03
R6168:Ahnak2 UTSW 12 112783122 missense probably benign 0.03
R6405:Ahnak2 UTSW 12 112773337 missense probably damaging 1.00
R6460:Ahnak2 UTSW 12 112786990 missense probably null 0.27
R6495:Ahnak2 UTSW 12 112773714 missense probably damaging 1.00
R6544:Ahnak2 UTSW 12 112780652 unclassified probably benign
R6656:Ahnak2 UTSW 12 112785371 missense probably benign 0.02
R6679:Ahnak2 UTSW 12 112772976 missense probably damaging 1.00
R6723:Ahnak2 UTSW 12 112778793 missense probably damaging 1.00
R6774:Ahnak2 UTSW 12 112773738 missense possibly damaging 0.87
R6884:Ahnak2 UTSW 12 112775429 missense possibly damaging 0.81
R6906:Ahnak2 UTSW 12 112785313 missense probably benign 0.00
R6919:Ahnak2 UTSW 12 112774684 missense possibly damaging 0.55
R7036:Ahnak2 UTSW 12 112778781 unclassified probably benign
R7037:Ahnak2 UTSW 12 112774278 missense probably damaging 0.99
R7064:Ahnak2 UTSW 12 112780742 unclassified probably benign
R7072:Ahnak2 UTSW 12 112788166 missense
R7112:Ahnak2 UTSW 12 112783119 missense
R7268:Ahnak2 UTSW 12 112780802 missense
R7269:Ahnak2 UTSW 12 112780802 missense
R7270:Ahnak2 UTSW 12 112780802 missense
R7271:Ahnak2 UTSW 12 112780802 missense
R7444:Ahnak2 UTSW 12 112781208 missense
R7448:Ahnak2 UTSW 12 112782502 missense
R7488:Ahnak2 UTSW 12 112785021 missense
R7508:Ahnak2 UTSW 12 112774405 missense possibly damaging 0.46
R7560:Ahnak2 UTSW 12 112779674 missense
R7611:Ahnak2 UTSW 12 112788129 missense
Predicted Primers PCR Primer
(F):5'- AACTTGCTGTCTTTGGCCG -3'
(R):5'- GAGTTCAAGATGCCCTCCTTC -3'

Sequencing Primer
(F):5'- TGTCTTTGGCCGCCACG -3'
(R):5'- TGAAGACCCCTGACCTGAG -3'
Posted On2015-07-21