Mutagenetix > Incidental Mutations

Incidental Mutation 'R4485:Nsd1'

331585

Institutional Source

Beutler Lab

Gene Symbol

Nsd1

Ensembl Gene

ENSMUSG00000021488

Gene Name

nuclear receptor-binding SET-domain protein 1

Synonyms

KMT3B

MMRRC Submission

041741-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4485 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

55209782-55318325 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 55245621 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 345 (V345A)

Ref Sequence

ENSEMBL: ENSMUSP00000153677 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099490] [ENSMUST00000224156] [ENSMUST00000224693] [ENSMUST00000224918] [ENSMUST00000224973]

Predicted Effect

probably benign
Transcript: ENSMUST00000099490
AA Change: V448A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000097089
Gene: ENSMUSG00000021488
AA Change: V448A

Domain	Start	End	E-Value	Type
low complexity region	177	187	N/A	INTRINSIC
low complexity region	281	289	N/A	INTRINSIC
PWWP	322	388	1.97e-3	SMART
low complexity region	635	644	N/A	INTRINSIC
low complexity region	980	1000	N/A	INTRINSIC
low complexity region	1296	1309	N/A	INTRINSIC
PHD	1546	1588	4.25e-8	SMART
PHD	1593	1640	3.79e-5	SMART
RING	1594	1639	1.08e-1	SMART
PHD	1641	1694	1.09e1	SMART
PHD	1710	1750	1.02e-10	SMART
PWWP	1755	1817	8.87e-29	SMART
AWS	1891	1942	3.02e-22	SMART
SET	1943	2066	1e-45	SMART
PostSET	2067	2083	3.99e-3	SMART
PHD	2121	2164	1.08e-9	SMART
low complexity region	2224	2237	N/A	INTRINSIC
low complexity region	2276	2286	N/A	INTRINSIC
low complexity region	2335	2356	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000224156

Predicted Effect

probably benign
Transcript: ENSMUST00000224693

Predicted Effect

probably benign
Transcript: ENSMUST00000224918

Predicted Effect

probably benign
Transcript: ENSMUST00000224973
AA Change: V345A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a SET domain, 2 LXXLL motifs, 3 nuclear translocation signals (NLSs), 4 plant homeodomain (PHD) finger regions, and a proline-rich region. The encoded protein enhances androgen receptor (AR) transactivation, and this enhancement can be increased further in the presence of other androgen receptor associated coregulators. This protein may act as a nucleus-localized, basic transcriptional factor and also as a bifunctional transcriptional regulator. Mutations of this gene have been associated with Sotos syndrome and Weaver syndrome. One version of childhood acute myeloid leukemia is the result of a cryptic translocation with the breakpoints occurring within nuclear receptor-binding Su-var, enhancer of zeste, and trithorax domain protein 1 on chromosome 5 and nucleoporin, 98-kd on chromosome 11. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit excess apoptosis and retarded growth, fail to complete gastrulation, and are resorbed by embryonic day 10. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agxt2	A	T	15: 10,378,882	I190L	possibly damaging	Het
Ahnak2	A	G	12: 112,779,767		probably benign	Het
Apol7b	C	A	15: 77,423,666	V210L	probably benign	Het
Banf2	C	T	2: 144,073,852	T71M	probably damaging	Het
Cacna1s	A	G	1: 136,076,852	D130G	probably damaging	Het
Capn8	T	C	1: 182,598,741	F214L	possibly damaging	Het
Ccdc129	A	G	6: 55,887,066	T126A	probably benign	Het
Cdk5rap2	A	T	4: 70,239,283		probably null	Het
Cldn8	A	C	16: 88,562,731	M102R	probably damaging	Het
Cpb1	T	G	3: 20,249,701	M400L	probably benign	Het
Eps15l1	A	T	8: 72,399,687	I52N	possibly damaging	Het
Gbp9	C	G	5: 105,083,808	G304A	probably damaging	Het
Gm14226	G	A	2: 155,025,271	V383I	probably benign	Het
Gm8251	A	G	1: 44,060,123	L605S	probably benign	Het
Npm2	A	T	14: 70,648,309	V152D	possibly damaging	Het
Olfr1461	T	C	19: 13,165,491	V159A	possibly damaging	Het
Olfr1474	T	C	19: 13,471,555	I195T	probably benign	Het
Olfr482	T	C	7: 108,095,015	D185G	probably benign	Het
Olfr679	T	A	7: 105,086,601	V295D	probably damaging	Het
Otof	T	A	5: 30,375,000	H1601L	possibly damaging	Het
Plat	G	A	8: 22,772,212	S84N	probably benign	Het
Prss30	T	C	17: 23,973,156	D224G	probably damaging	Het
Psg25	C	A	7: 18,526,278	V232F	probably damaging	Het
Ptch1	C	T	13: 63,534,329	R537H	probably damaging	Het
Pus7l	G	T	15: 94,523,490	H646Q	probably benign	Het
Ryr1	C	T	7: 29,090,156	S1511N	probably damaging	Het
Slc16a1	A	G	3: 104,655,478	K413R	probably benign	Het
Snrnp48	T	A	13: 38,216,328	M137K	probably benign	Het
Tecta	T	A	9: 42,337,274	H1944L	possibly damaging	Het
Tmem145	A	G	7: 25,307,162	E65G	possibly damaging	Het
Vmn2r87	A	T	10: 130,479,809	Y129*	probably null	Het
Wdr7	A	G	18: 63,777,550	H671R	possibly damaging	Het
Zfp219	A	G	14: 52,007,384	V518A	probably damaging	Het
Zfp472	T	C	17: 32,977,568	W206R	possibly damaging	Het

Other mutations in Nsd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00777:Nsd1	APN	13	55238735	missense	probably damaging	1.00
IGL01060:Nsd1	APN	13	55263429	missense	probably damaging	1.00
IGL01125:Nsd1	APN	13	55245617	missense	probably damaging	1.00
IGL01746:Nsd1	APN	13	55276515	splice site	probably null
IGL02437:Nsd1	APN	13	55313441	missense	probably damaging	1.00
IGL02530:Nsd1	APN	13	55302833	splice site	probably benign
IGL02557:Nsd1	APN	13	55312448	missense	probably damaging	1.00
IGL02572:Nsd1	APN	13	55296130	missense	probably damaging	1.00
IGL02665:Nsd1	APN	13	55296183	missense	probably damaging	1.00
IGL02870:Nsd1	APN	13	55313603	missense	probably benign	0.06
IGL03181:Nsd1	APN	13	55247045	missense	probably damaging	1.00
Amanuensis	UTSW	13	55261626	nonsense	probably null
scribe	UTSW	13	55291236	missense	probably damaging	1.00
stenographer	UTSW	13	55298376	splice site	probably null
PIT4480001:Nsd1	UTSW	13	55213918	missense	probably benign	0.11
R0316:Nsd1	UTSW	13	55213771	missense	probably damaging	0.98
R0519:Nsd1	UTSW	13	55312835	missense	probably benign	0.04
R0542:Nsd1	UTSW	13	55260458	missense	possibly damaging	0.93
R0563:Nsd1	UTSW	13	55246578	missense	possibly damaging	0.48
R0652:Nsd1	UTSW	13	55247586	missense	possibly damaging	0.92
R0906:Nsd1	UTSW	13	55277590	missense	probably benign	0.30
R1560:Nsd1	UTSW	13	55246720	nonsense	probably null
R1572:Nsd1	UTSW	13	55246969	missense	probably damaging	0.98
R1693:Nsd1	UTSW	13	55247261	missense	probably benign
R1697:Nsd1	UTSW	13	55214059	critical splice acceptor site	probably null
R1720:Nsd1	UTSW	13	55246898	missense	probably damaging	0.98
R1829:Nsd1	UTSW	13	55246369	missense	probably damaging	1.00
R1834:Nsd1	UTSW	13	55313351	missense	possibly damaging	0.52
R1842:Nsd1	UTSW	13	55246445	missense	probably damaging	1.00
R1880:Nsd1	UTSW	13	55213793	missense	probably damaging	0.99
R2022:Nsd1	UTSW	13	55213279	missense	probably damaging	0.99
R2075:Nsd1	UTSW	13	55310500	missense	possibly damaging	0.74
R2143:Nsd1	UTSW	13	55260397	missense	probably damaging	1.00
R2151:Nsd1	UTSW	13	55291236	missense	probably damaging	1.00
R2316:Nsd1	UTSW	13	55233966	missense	probably damaging	1.00
R2359:Nsd1	UTSW	13	55213711	missense	possibly damaging	0.90
R2361:Nsd1	UTSW	13	55213711	missense	possibly damaging	0.90
R2656:Nsd1	UTSW	13	55246868	missense	probably damaging	1.00
R2849:Nsd1	UTSW	13	55213692	missense	probably damaging	0.99
R3237:Nsd1	UTSW	13	55312888	missense	possibly damaging	0.92
R3772:Nsd1	UTSW	13	55246673	missense	probably benign	0.00
R3773:Nsd1	UTSW	13	55246673	missense	probably benign	0.00
R3849:Nsd1	UTSW	13	55246691	missense	probably benign	0.00
R3951:Nsd1	UTSW	13	55268454	missense	probably benign	0.05
R4036:Nsd1	UTSW	13	55213711	missense	possibly damaging	0.90
R4073:Nsd1	UTSW	13	55247728	missense	probably benign	0.28
R4080:Nsd1	UTSW	13	55301809	missense	probably damaging	0.96
R4226:Nsd1	UTSW	13	55260401	missense	probably damaging	1.00
R4703:Nsd1	UTSW	13	55214063	missense	probably damaging	1.00
R4853:Nsd1	UTSW	13	55268504	missense	probably benign	0.30
R4915:Nsd1	UTSW	13	55247868	missense	possibly damaging	0.65
R4915:Nsd1	UTSW	13	55276528	missense	probably benign	0.00
R5264:Nsd1	UTSW	13	55247346	missense	possibly damaging	0.49
R5348:Nsd1	UTSW	13	55312334	missense	probably benign	0.00
R5473:Nsd1	UTSW	13	55247772	missense	probably damaging	1.00
R5498:Nsd1	UTSW	13	55213302	nonsense	probably null
R5503:Nsd1	UTSW	13	55245939	missense	probably damaging	1.00
R5511:Nsd1	UTSW	13	55312730	missense	probably benign	0.00
R5683:Nsd1	UTSW	13	55246148	missense	probably benign	0.00
R5778:Nsd1	UTSW	13	55306979	missense	probably damaging	1.00
R5793:Nsd1	UTSW	13	55248006	missense	probably benign
R5922:Nsd1	UTSW	13	55247475	missense	probably benign	0.01
R5956:Nsd1	UTSW	13	55263404	missense	probably damaging	1.00
R6053:Nsd1	UTSW	13	55293609	missense	probably damaging	1.00
R6141:Nsd1	UTSW	13	55291284	missense	probably damaging	1.00
R6158:Nsd1	UTSW	13	55245621	missense	probably benign
R6224:Nsd1	UTSW	13	55313132	missense	possibly damaging	0.85
R6396:Nsd1	UTSW	13	55238789	missense	probably damaging	1.00
R6598:Nsd1	UTSW	13	55293702	missense	possibly damaging	0.94
R7170:Nsd1	UTSW	13	55261626	nonsense	probably null
R7205:Nsd1	UTSW	13	55246470	missense	probably damaging	1.00
R7215:Nsd1	UTSW	13	55247641	missense	probably benign	0.00
R7337:Nsd1	UTSW	13	55246209	missense	probably damaging	1.00
R7432:Nsd1	UTSW	13	55213374	missense	probably benign
R7638:Nsd1	UTSW	13	55312328	missense	probably benign	0.01
R7647:Nsd1	UTSW	13	55299835	missense	probably damaging	0.96
R7658:Nsd1	UTSW	13	55277639	missense	probably damaging	1.00
R7884:Nsd1	UTSW	13	55313255	missense	probably damaging	0.99
R8032:Nsd1	UTSW	13	55310383	missense	probably damaging	1.00
R8113:Nsd1	UTSW	13	55245621	missense	probably benign
R8152:Nsd1	UTSW	13	55310367	missense	possibly damaging	0.49
R8183:Nsd1	UTSW	13	55312373	missense	probably damaging	1.00
R8432:Nsd1	UTSW	13	55247703	missense	possibly damaging	0.91
R8462:Nsd1	UTSW	13	55298376	splice site	probably null
R8469:Nsd1	UTSW	13	55277553	missense	possibly damaging	0.76
R8756:Nsd1	UTSW	13	55313693	missense	probably benign	0.00
R8867:Nsd1	UTSW	13	55282757	missense	probably damaging	1.00
Z1088:Nsd1	UTSW	13	55213848	missense	possibly damaging	0.83
Z1176:Nsd1	UTSW	13	55245525	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTGGCTTCAGAAAGGGGAC -3'
(R):5'- ACGTGATTCAAATGGCACCAG -3'

Sequencing Primer
(F):5'- GAATGTGAGACCAGCTTGTTCTACC -3'
(R):5'- AAATGGCACCAGATCCTTTTTCAC -3'

Posted On

2015-07-21