Incidental Mutation 'R4485:Apol7b'
ID331590
Institutional Source Beutler Lab
Gene Symbol Apol7b
Ensembl Gene ENSMUSG00000068252
Gene Nameapolipoprotein L 7b
Synonyms
MMRRC Submission 041741-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R4485 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location77422209-77447492 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 77423666 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 210 (V210L)
Ref Sequence ENSEMBL: ENSMUSP00000086894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089469] [ENSMUST00000229434]
Predicted Effect probably benign
Transcript: ENSMUST00000089469
AA Change: V210L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000086894
Gene: ENSMUSG00000068252
AA Change: V210L

DomainStartEndE-ValueType
Pfam:ApoL 20 82 7.9e-15 PFAM
Pfam:ApoL 77 367 1.9e-123 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142914
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149824
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229381
Predicted Effect probably benign
Transcript: ENSMUST00000229434
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agxt2 A T 15: 10,378,882 I190L possibly damaging Het
Ahnak2 A G 12: 112,779,767 probably benign Het
Banf2 C T 2: 144,073,852 T71M probably damaging Het
Cacna1s A G 1: 136,076,852 D130G probably damaging Het
Capn8 T C 1: 182,598,741 F214L possibly damaging Het
Ccdc129 A G 6: 55,887,066 T126A probably benign Het
Cdk5rap2 A T 4: 70,239,283 probably null Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cpb1 T G 3: 20,249,701 M400L probably benign Het
Eps15l1 A T 8: 72,399,687 I52N possibly damaging Het
Gbp9 C G 5: 105,083,808 G304A probably damaging Het
Gm14226 G A 2: 155,025,271 V383I probably benign Het
Gm8251 A G 1: 44,060,123 L605S probably benign Het
Npm2 A T 14: 70,648,309 V152D possibly damaging Het
Nsd1 T C 13: 55,245,621 V345A probably benign Het
Olfr1461 T C 19: 13,165,491 V159A possibly damaging Het
Olfr1474 T C 19: 13,471,555 I195T probably benign Het
Olfr482 T C 7: 108,095,015 D185G probably benign Het
Olfr679 T A 7: 105,086,601 V295D probably damaging Het
Otof T A 5: 30,375,000 H1601L possibly damaging Het
Plat G A 8: 22,772,212 S84N probably benign Het
Prss30 T C 17: 23,973,156 D224G probably damaging Het
Psg25 C A 7: 18,526,278 V232F probably damaging Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Pus7l G T 15: 94,523,490 H646Q probably benign Het
Ryr1 C T 7: 29,090,156 S1511N probably damaging Het
Slc16a1 A G 3: 104,655,478 K413R probably benign Het
Snrnp48 T A 13: 38,216,328 M137K probably benign Het
Tecta T A 9: 42,337,274 H1944L possibly damaging Het
Tmem145 A G 7: 25,307,162 E65G possibly damaging Het
Vmn2r87 A T 10: 130,479,809 Y129* probably null Het
Wdr7 A G 18: 63,777,550 H671R possibly damaging Het
Zfp219 A G 14: 52,007,384 V518A probably damaging Het
Zfp472 T C 17: 32,977,568 W206R possibly damaging Het
Other mutations in Apol7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Apol7b APN 15 77423914 missense probably damaging 1.00
IGL02081:Apol7b APN 15 77423536 missense possibly damaging 0.83
IGL02350:Apol7b APN 15 77423632 missense probably benign 0.05
IGL02357:Apol7b APN 15 77423632 missense probably benign 0.05
R0506:Apol7b UTSW 15 77425528 missense probably benign 0.02
R1187:Apol7b UTSW 15 77423403 missense possibly damaging 0.94
R1433:Apol7b UTSW 15 77425546 missense probably damaging 1.00
R1978:Apol7b UTSW 15 77423339 missense probably damaging 0.99
R2272:Apol7b UTSW 15 77423710 missense probably damaging 1.00
R4012:Apol7b UTSW 15 77424709 missense probably damaging 0.98
R4571:Apol7b UTSW 15 77423534 missense probably benign 0.01
R4823:Apol7b UTSW 15 77427782 utr 5 prime probably benign
R5018:Apol7b UTSW 15 77424716 missense probably benign 0.03
R5944:Apol7b UTSW 15 77423767 missense probably damaging 0.99
R6514:Apol7b UTSW 15 77423926 missense probably benign 0.00
R6519:Apol7b UTSW 15 77423348 missense probably benign 0.01
R6808:Apol7b UTSW 15 77424673 missense probably damaging 1.00
R6904:Apol7b UTSW 15 77423425 missense probably benign 0.09
R7570:Apol7b UTSW 15 77423474 missense probably benign 0.00
R7571:Apol7b UTSW 15 77423477 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AGCATTAGTTACAAGGCTAGGG -3'
(R):5'- TTGACAAGGTGCACAGGGAC -3'

Sequencing Primer
(F):5'- CATTAGTTACAAGGCTAGGGTTGGC -3'
(R):5'- AGGGACTGCACCATCTCACG -3'
Posted On2015-07-21