Incidental Mutation 'R4485:Pus7l'
ID331591
Institutional Source Beutler Lab
Gene Symbol Pus7l
Ensembl Gene ENSMUSG00000033356
Gene Namepseudouridylate synthase 7-like
Synonyms
MMRRC Submission 041741-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4485 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location94522688-94543547 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 94523490 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 646 (H646Q)
Ref Sequence ENSEMBL: ENSMUSP00000044075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049151]
Predicted Effect probably benign
Transcript: ENSMUST00000049151
AA Change: H646Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000044075
Gene: ENSMUSG00000033356
AA Change: H646Q

DomainStartEndE-ValueType
Pfam:TruD 280 697 1e-70 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agxt2 A T 15: 10,378,882 I190L possibly damaging Het
Ahnak2 A G 12: 112,779,767 probably benign Het
Apol7b C A 15: 77,423,666 V210L probably benign Het
Banf2 C T 2: 144,073,852 T71M probably damaging Het
Cacna1s A G 1: 136,076,852 D130G probably damaging Het
Capn8 T C 1: 182,598,741 F214L possibly damaging Het
Ccdc129 A G 6: 55,887,066 T126A probably benign Het
Cdk5rap2 A T 4: 70,239,283 probably null Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cpb1 T G 3: 20,249,701 M400L probably benign Het
Eps15l1 A T 8: 72,399,687 I52N possibly damaging Het
Gbp9 C G 5: 105,083,808 G304A probably damaging Het
Gm14226 G A 2: 155,025,271 V383I probably benign Het
Gm8251 A G 1: 44,060,123 L605S probably benign Het
Npm2 A T 14: 70,648,309 V152D possibly damaging Het
Nsd1 T C 13: 55,245,621 V345A probably benign Het
Olfr1461 T C 19: 13,165,491 V159A possibly damaging Het
Olfr1474 T C 19: 13,471,555 I195T probably benign Het
Olfr482 T C 7: 108,095,015 D185G probably benign Het
Olfr679 T A 7: 105,086,601 V295D probably damaging Het
Otof T A 5: 30,375,000 H1601L possibly damaging Het
Plat G A 8: 22,772,212 S84N probably benign Het
Prss30 T C 17: 23,973,156 D224G probably damaging Het
Psg25 C A 7: 18,526,278 V232F probably damaging Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Ryr1 C T 7: 29,090,156 S1511N probably damaging Het
Slc16a1 A G 3: 104,655,478 K413R probably benign Het
Snrnp48 T A 13: 38,216,328 M137K probably benign Het
Tecta T A 9: 42,337,274 H1944L possibly damaging Het
Tmem145 A G 7: 25,307,162 E65G possibly damaging Het
Vmn2r87 A T 10: 130,479,809 Y129* probably null Het
Wdr7 A G 18: 63,777,550 H671R possibly damaging Het
Zfp219 A G 14: 52,007,384 V518A probably damaging Het
Zfp472 T C 17: 32,977,568 W206R possibly damaging Het
Other mutations in Pus7l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01713:Pus7l APN 15 94531612 missense probably benign 0.07
IGL02049:Pus7l APN 15 94540178 missense probably damaging 1.00
IGL02484:Pus7l APN 15 94529488 missense possibly damaging 0.70
IGL02731:Pus7l APN 15 94523464 missense probably benign 0.03
IGL03252:Pus7l APN 15 94525810 missense probably benign 0.00
IGL03392:Pus7l APN 15 94536568 missense probably damaging 1.00
R0638:Pus7l UTSW 15 94523417 missense probably benign 0.20
R0848:Pus7l UTSW 15 94540512 missense probably benign 0.16
R1646:Pus7l UTSW 15 94533636 missense probably benign 0.33
R1785:Pus7l UTSW 15 94540637 missense probably benign 0.04
R2046:Pus7l UTSW 15 94540785 missense probably benign 0.01
R2206:Pus7l UTSW 15 94523590 missense probably damaging 1.00
R2210:Pus7l UTSW 15 94540292 missense possibly damaging 0.95
R3618:Pus7l UTSW 15 94527907 missense probably damaging 0.97
R4487:Pus7l UTSW 15 94531617 missense possibly damaging 0.46
R4686:Pus7l UTSW 15 94540211 missense probably damaging 1.00
R4739:Pus7l UTSW 15 94540710 missense probably benign 0.02
R4975:Pus7l UTSW 15 94529488 missense possibly damaging 0.70
R5431:Pus7l UTSW 15 94529486 missense probably damaging 1.00
R5567:Pus7l UTSW 15 94527865 missense probably benign 0.00
R5570:Pus7l UTSW 15 94527865 missense probably benign 0.00
R5896:Pus7l UTSW 15 94529451 splice site probably null
R6408:Pus7l UTSW 15 94531575 missense probably benign 0.06
R6681:Pus7l UTSW 15 94527865 missense probably benign 0.00
R7344:Pus7l UTSW 15 94540617 missense probably benign 0.01
R7811:Pus7l UTSW 15 94540826 missense probably damaging 1.00
X0065:Pus7l UTSW 15 94540773 missense possibly damaging 0.87
X0066:Pus7l UTSW 15 94529493 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TGACATCAGGGTGTGTGAGC -3'
(R):5'- TTTCTGAAGGCTAATCCACAGGC -3'

Sequencing Primer
(F):5'- TGTGAGCTTAAATGTCGCCC -3'
(R):5'- ACAGGCCGTGGTTTCTCC -3'
Posted On2015-07-21