Incidental Mutation 'R4486:Crispld1'
ID 331598
Institutional Source Beutler Lab
Gene Symbol Crispld1
Ensembl Gene ENSMUSG00000025776
Gene Name cysteine-rich secretory protein LCCL domain containing 1
Synonyms Cocoacrisp
MMRRC Submission 041742-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock # R4486 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 17727045-17766344 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 17752878 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 390 (T390A)
Ref Sequence ENSEMBL: ENSMUSP00000124095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095075] [ENSMUST00000159958]
AlphaFold Q8CGD2
Predicted Effect probably benign
Transcript: ENSMUST00000095075
AA Change: T390A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000092686
Gene: ENSMUSG00000025776
AA Change: T390A

DomainStartEndE-ValueType
SCP 60 214 1.63e-41 SMART
LCCL 291 375 1.6e-52 SMART
LCCL 392 483 1.55e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159958
AA Change: T390A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000124095
Gene: ENSMUSG00000025776
AA Change: T390A

DomainStartEndE-ValueType
SCP 60 214 1.63e-41 SMART
LCCL 291 375 1.6e-52 SMART
LCCL 392 483 1.55e-59 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189853
Meta Mutation Damage Score 0.1127 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 94% (45/48)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 A G 15: 91,178,283 V484A probably damaging Het
Adam22 A T 5: 8,180,227 probably benign Het
Adamts18 G T 8: 113,713,193 P923T probably benign Het
AI314180 A G 4: 58,820,086 probably benign Het
Ank3 C T 10: 70,001,974 T1604I possibly damaging Het
Armc10 A G 5: 21,653,434 Q159R probably damaging Het
Arnt2 T A 7: 84,275,345 T425S probably benign Het
B4galt3 A G 1: 171,271,773 T36A possibly damaging Het
Bbx A G 16: 50,200,414 V799A probably damaging Het
Bud23 T C 5: 135,063,925 probably null Het
Cnga2 T A X: 72,006,127 F133I possibly damaging Het
Cyp4f39 T A 17: 32,483,454 D308E probably damaging Het
Dnah6 A G 6: 73,038,746 V3584A probably damaging Het
Frk T C 10: 34,608,381 I450T probably benign Het
Grm6 T C 11: 50,859,989 S660P probably damaging Het
Hao2 T A 3: 98,882,025 I116F probably damaging Het
Hyi G A 4: 118,362,477 G237D probably damaging Het
Jrkl T C 9: 13,245,371 N95S probably benign Het
Kif1bp A G 10: 62,563,027 probably benign Het
Nanog T C 6: 122,712,717 probably null Het
Ngf G A 3: 102,520,699 D255N probably damaging Het
Nlrp4e A G 7: 23,321,227 I380V probably benign Het
Olfr676 T C 7: 105,035,303 F35S probably benign Het
Olfr813 T C 10: 129,856,698 F60S probably damaging Het
Pcdha3 T C 18: 36,947,351 V382A probably damaging Het
Pla2g4c T A 7: 13,337,751 N165K probably benign Het
Rexo5 T C 7: 119,825,577 I362T probably benign Het
Rpl7a-ps3 G A 15: 36,308,283 noncoding transcript Het
Rpusd2 T C 2: 119,035,224 V134A probably damaging Het
Serpina1c T A 12: 103,897,000 probably null Het
Slc6a19 A T 13: 73,681,717 I606N probably damaging Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Tas2r143 A G 6: 42,400,694 M153V probably benign Het
Thrb G T 14: 17,925,640 M1I probably null Het
Trbc2 A G 6: 41,546,880 probably benign Het
Trim37 T A 11: 87,196,825 S587R probably benign Het
Ulbp1 T A 10: 7,447,397 H151L probably benign Het
Vmn2r54 A T 7: 12,632,272 L245* probably null Het
Vmn2r78 A C 7: 86,920,751 probably null Het
Xlr5b T C X: 73,157,898 probably null Het
Xrcc4 A C 13: 89,992,588 S167R possibly damaging Het
Zfp994 C T 17: 22,201,560 C136Y probably damaging Het
Other mutations in Crispld1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Crispld1 APN 1 17746801 missense probably benign 0.21
IGL01610:Crispld1 APN 1 17746725 splice site probably null
IGL01991:Crispld1 APN 1 17753017 missense probably benign
IGL02004:Crispld1 APN 1 17747520 missense probably damaging 1.00
IGL02178:Crispld1 APN 1 17762103 splice site probably benign
IGL02200:Crispld1 APN 1 17750333 unclassified probably benign
IGL02251:Crispld1 APN 1 17728840 missense probably benign 0.06
IGL02506:Crispld1 APN 1 17756305 missense probably damaging 0.99
IGL02883:Crispld1 APN 1 17746789 missense possibly damaging 0.87
IGL03310:Crispld1 APN 1 17745477 splice site probably benign
milliliter UTSW 1 17750801 missense possibly damaging 0.81
Spoonful UTSW 1 17762141 missense probably damaging 1.00
R0068:Crispld1 UTSW 1 17752988 missense possibly damaging 0.89
R0324:Crispld1 UTSW 1 17749591 missense probably benign
R0542:Crispld1 UTSW 1 17746768 missense possibly damaging 0.75
R1117:Crispld1 UTSW 1 17749622 missense probably benign 0.03
R1157:Crispld1 UTSW 1 17745363 missense possibly damaging 0.70
R1585:Crispld1 UTSW 1 17750800 missense possibly damaging 0.68
R1630:Crispld1 UTSW 1 17728798 missense probably benign
R2081:Crispld1 UTSW 1 17762179 missense probably damaging 0.99
R2143:Crispld1 UTSW 1 17749636 missense probably benign
R2472:Crispld1 UTSW 1 17745828 missense probably null 0.12
R2520:Crispld1 UTSW 1 17750776 missense probably damaging 1.00
R4476:Crispld1 UTSW 1 17747510 missense probably damaging 1.00
R4779:Crispld1 UTSW 1 17749607 missense probably benign
R5508:Crispld1 UTSW 1 17752983 missense probably damaging 1.00
R5568:Crispld1 UTSW 1 17750271 missense probably benign 0.01
R6155:Crispld1 UTSW 1 17753017 missense probably benign
R6252:Crispld1 UTSW 1 17749507 missense probably benign 0.00
R6361:Crispld1 UTSW 1 17762231 missense probably damaging 0.99
R6617:Crispld1 UTSW 1 17728662 missense probably benign 0.02
R6760:Crispld1 UTSW 1 17750801 missense possibly damaging 0.81
R6961:Crispld1 UTSW 1 17762141 missense probably damaging 1.00
R7278:Crispld1 UTSW 1 17752878 missense probably benign 0.01
R7403:Crispld1 UTSW 1 17747596 missense probably damaging 1.00
R7592:Crispld1 UTSW 1 17728766 missense possibly damaging 0.64
R7837:Crispld1 UTSW 1 17728730 missense probably benign 0.42
R8906:Crispld1 UTSW 1 17750771 missense possibly damaging 0.95
R9331:Crispld1 UTSW 1 17762230 missense probably damaging 0.99
R9477:Crispld1 UTSW 1 17746732 missense probably benign 0.44
Z1088:Crispld1 UTSW 1 17764076 missense probably benign
Z1176:Crispld1 UTSW 1 17728613 start gained probably benign
Z1176:Crispld1 UTSW 1 17752851 missense possibly damaging 0.60
Z1177:Crispld1 UTSW 1 17764092 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTTAAACTGGTTCTGTGGAGAAATGAC -3'
(R):5'- GGATTACCTGGGGCAATGAG -3'

Sequencing Primer
(F):5'- CTGGTTCTGTGGAGAAATGACATGAG -3'
(R):5'- TTACCTGGGGCAATGAGAAGCAG -3'
Posted On 2015-07-21