Incidental Mutation 'R4486:Vmn2r78'
ID 331616
Institutional Source Beutler Lab
Gene Symbol Vmn2r78
Ensembl Gene ENSMUSG00000091962
Gene Name vomeronasal 2, receptor 78
Synonyms
MMRRC Submission 041742-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock # R4486 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 86915300-86955177 bp(+) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to C at 86920751 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170835] [ENSMUST00000170835] [ENSMUST00000170835]
AlphaFold K7N6U5
Predicted Effect probably null
Transcript: ENSMUST00000170835
SMART Domains Protein: ENSMUSP00000126698
Gene: ENSMUSG00000091962

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 75 464 5.9e-31 PFAM
Pfam:NCD3G 507 559 8.1e-21 PFAM
Pfam:7tm_3 592 827 1e-52 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170835
SMART Domains Protein: ENSMUSP00000126698
Gene: ENSMUSG00000091962

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 75 464 5.9e-31 PFAM
Pfam:NCD3G 507 559 8.1e-21 PFAM
Pfam:7tm_3 592 827 1e-52 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170835
SMART Domains Protein: ENSMUSP00000126698
Gene: ENSMUSG00000091962

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 75 464 5.9e-31 PFAM
Pfam:NCD3G 507 559 8.1e-21 PFAM
Pfam:7tm_3 592 827 1e-52 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 94% (45/48)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 A G 15: 91,178,283 V484A probably damaging Het
Adam22 A T 5: 8,180,227 probably benign Het
Adamts18 G T 8: 113,713,193 P923T probably benign Het
AI314180 A G 4: 58,820,086 probably benign Het
Ank3 C T 10: 70,001,974 T1604I possibly damaging Het
Armc10 A G 5: 21,653,434 Q159R probably damaging Het
Arnt2 T A 7: 84,275,345 T425S probably benign Het
B4galt3 A G 1: 171,271,773 T36A possibly damaging Het
Bbx A G 16: 50,200,414 V799A probably damaging Het
Bud23 T C 5: 135,063,925 probably null Het
Cnga2 T A X: 72,006,127 F133I possibly damaging Het
Crispld1 A G 1: 17,752,878 T390A probably benign Het
Cyp4f39 T A 17: 32,483,454 D308E probably damaging Het
Dnah6 A G 6: 73,038,746 V3584A probably damaging Het
Frk T C 10: 34,608,381 I450T probably benign Het
Grm6 T C 11: 50,859,989 S660P probably damaging Het
Hao2 T A 3: 98,882,025 I116F probably damaging Het
Hyi G A 4: 118,362,477 G237D probably damaging Het
Jrkl T C 9: 13,245,371 N95S probably benign Het
Kif1bp A G 10: 62,563,027 probably benign Het
Nanog T C 6: 122,712,717 probably null Het
Ngf G A 3: 102,520,699 D255N probably damaging Het
Nlrp4e A G 7: 23,321,227 I380V probably benign Het
Olfr676 T C 7: 105,035,303 F35S probably benign Het
Olfr813 T C 10: 129,856,698 F60S probably damaging Het
Pcdha3 T C 18: 36,947,351 V382A probably damaging Het
Pla2g4c T A 7: 13,337,751 N165K probably benign Het
Rexo5 T C 7: 119,825,577 I362T probably benign Het
Rpl7a-ps3 G A 15: 36,308,283 noncoding transcript Het
Rpusd2 T C 2: 119,035,224 V134A probably damaging Het
Serpina1c T A 12: 103,897,000 probably null Het
Slc6a19 A T 13: 73,681,717 I606N probably damaging Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Tas2r143 A G 6: 42,400,694 M153V probably benign Het
Thrb G T 14: 17,925,640 M1I probably null Het
Trbc2 A G 6: 41,546,880 probably benign Het
Trim37 T A 11: 87,196,825 S587R probably benign Het
Ulbp1 T A 10: 7,447,397 H151L probably benign Het
Vmn2r54 A T 7: 12,632,272 L245* probably null Het
Xlr5b T C X: 73,157,898 probably null Het
Xrcc4 A C 13: 89,992,588 S167R possibly damaging Het
Zfp994 C T 17: 22,201,560 C136Y probably damaging Het
Other mutations in Vmn2r78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Vmn2r78 APN 7 86915361 missense unknown
IGL01473:Vmn2r78 APN 7 86920312 missense possibly damaging 0.61
IGL01767:Vmn2r78 APN 7 86954435 missense probably benign 0.28
IGL02322:Vmn2r78 APN 7 86921479 missense probably damaging 0.96
IGL02537:Vmn2r78 APN 7 86954288 missense probably damaging 0.99
IGL03297:Vmn2r78 APN 7 86920761 nonsense probably null
ANU74:Vmn2r78 UTSW 7 86921065 missense possibly damaging 0.62
R0035:Vmn2r78 UTSW 7 86920205 missense probably benign 0.22
R0081:Vmn2r78 UTSW 7 86923027 missense probably benign 0.35
R0401:Vmn2r78 UTSW 7 86921311 missense probably benign 0.04
R0751:Vmn2r78 UTSW 7 86954380 missense possibly damaging 0.77
R1341:Vmn2r78 UTSW 7 86922269 missense possibly damaging 0.71
R1386:Vmn2r78 UTSW 7 86915407 missense unknown
R1526:Vmn2r78 UTSW 7 86922257 splice site probably null
R1712:Vmn2r78 UTSW 7 86954924 missense probably damaging 1.00
R1739:Vmn2r78 UTSW 7 86920789 missense probably benign
R1812:Vmn2r78 UTSW 7 86920787 missense probably benign 0.38
R2011:Vmn2r78 UTSW 7 86955079 missense possibly damaging 0.52
R2144:Vmn2r78 UTSW 7 86954482 missense probably damaging 1.00
R2197:Vmn2r78 UTSW 7 86921327 missense probably damaging 0.96
R2291:Vmn2r78 UTSW 7 86920154 missense probably damaging 1.00
R2409:Vmn2r78 UTSW 7 86920745 splice site probably benign
R3023:Vmn2r78 UTSW 7 86954966 missense probably damaging 1.00
R4512:Vmn2r78 UTSW 7 86920244 missense probably benign 0.00
R4515:Vmn2r78 UTSW 7 86954258 missense probably damaging 0.99
R4544:Vmn2r78 UTSW 7 86921191 missense probably benign
R4546:Vmn2r78 UTSW 7 86954603 missense probably damaging 1.00
R4872:Vmn2r78 UTSW 7 86954708 missense possibly damaging 0.87
R4928:Vmn2r78 UTSW 7 86954627 missense probably damaging 1.00
R5101:Vmn2r78 UTSW 7 86922355 missense probably damaging 1.00
R5265:Vmn2r78 UTSW 7 86920124 missense probably damaging 1.00
R5328:Vmn2r78 UTSW 7 86921030 missense probably damaging 0.98
R5442:Vmn2r78 UTSW 7 86920122 missense possibly damaging 0.95
R5567:Vmn2r78 UTSW 7 86921529 missense probably benign 0.17
R5572:Vmn2r78 UTSW 7 86915512 missense probably benign 0.01
R5636:Vmn2r78 UTSW 7 86954429 missense probably damaging 0.99
R5901:Vmn2r78 UTSW 7 86954588 missense probably damaging 1.00
R5977:Vmn2r78 UTSW 7 86920333 missense possibly damaging 0.74
R5977:Vmn2r78 UTSW 7 86954907 missense probably benign 0.00
R6276:Vmn2r78 UTSW 7 86921110 missense probably benign 0.00
R6386:Vmn2r78 UTSW 7 86922337 nonsense probably null
R6724:Vmn2r78 UTSW 7 86954258 missense probably damaging 0.99
R6852:Vmn2r78 UTSW 7 86954603 missense probably damaging 1.00
R6896:Vmn2r78 UTSW 7 86922350 missense probably benign 0.10
R7385:Vmn2r78 UTSW 7 86922425 missense probably benign 0.18
R7578:Vmn2r78 UTSW 7 86954344 nonsense probably null
R7680:Vmn2r78 UTSW 7 86954941 missense probably damaging 1.00
R7748:Vmn2r78 UTSW 7 86921135 missense probably benign 0.00
R7852:Vmn2r78 UTSW 7 86920170 nonsense probably null
R8031:Vmn2r78 UTSW 7 86954867 missense probably damaging 1.00
R8070:Vmn2r78 UTSW 7 86922487 missense probably benign 0.01
R8085:Vmn2r78 UTSW 7 86954790 missense probably benign 0.00
R8163:Vmn2r78 UTSW 7 86954452 missense probably damaging 1.00
R8501:Vmn2r78 UTSW 7 86920886 missense probably damaging 0.99
R8749:Vmn2r78 UTSW 7 86954305 missense possibly damaging 0.81
R9209:Vmn2r78 UTSW 7 86920223 missense probably benign 0.08
RF018:Vmn2r78 UTSW 7 86954431 nonsense probably null
Z1177:Vmn2r78 UTSW 7 86921207 missense probably benign 0.44
Z1177:Vmn2r78 UTSW 7 86954774 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AACTTTATGACAAATGGGCAGG -3'
(R):5'- CTGAATTCCATGGTCATCATCTG -3'

Sequencing Primer
(F):5'- CCAGACGATTTAGTTATCTGTACTTG -3'
(R):5'- ATCTGTAATGATGACTCCTACCCAG -3'
Posted On 2015-07-21