Incidental Mutation 'R4486:Adamts18'
ID 331619
Institutional Source Beutler Lab
Gene Symbol Adamts18
Ensembl Gene ENSMUSG00000053399
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 18
Synonyms E130314N14Rik
MMRRC Submission 041742-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.127) question?
Stock # R4486 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 114423758-114575370 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 114439825 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Threonine at position 923 (P923T)
Ref Sequence ENSEMBL: ENSMUSP00000090801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093113] [ENSMUST00000212665]
AlphaFold Q4VC17
Predicted Effect probably benign
Transcript: ENSMUST00000093113
AA Change: P923T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000090801
Gene: ENSMUSG00000053399
AA Change: P923T

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
Pfam:Pep_M12B_propep 63 203 3.4e-37 PFAM
Pfam:Reprolysin_5 292 473 1.3e-14 PFAM
Pfam:Reprolysin_4 294 494 2.6e-11 PFAM
Pfam:Reprolysin 294 498 2.7e-30 PFAM
Pfam:Reprolysin_2 311 488 1.7e-14 PFAM
Pfam:Reprolysin_3 315 447 1.5e-11 PFAM
TSP1 592 644 7.37e-17 SMART
Pfam:ADAM_spacer1 749 861 1.7e-38 PFAM
TSP1 878 932 1.55e-1 SMART
TSP1 934 992 5.07e-6 SMART
TSP1 994 1049 1.65e-5 SMART
TSP1 1055 1116 1.71e-3 SMART
TSP1 1125 1171 5.27e-4 SMART
Pfam:PLAC 1186 1216 1.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212437
Predicted Effect probably benign
Transcript: ENSMUST00000212665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213076
Meta Mutation Damage Score 0.0827 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. ADAMTS family members share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protein, which may regulate hemostatic balance and function as a tumor suppressor. Mutations in this gene may be associated with microcornea, myopic chorioretinal atrophy, and telecanthus (MMCAT) and cone-rod dystrophy in human patients. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a floxed allele exhibit some fertility defects. Mice homozygous for a null allele exhibit growth and eye defects and increased susceptibility to chemically induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 A G 15: 91,062,486 (GRCm39) V484A probably damaging Het
Adam22 A T 5: 8,230,227 (GRCm39) probably benign Het
Ank3 C T 10: 69,837,804 (GRCm39) T1604I possibly damaging Het
Armc10 A G 5: 21,858,432 (GRCm39) Q159R probably damaging Het
Arnt2 T A 7: 83,924,553 (GRCm39) T425S probably benign Het
B4galt3 A G 1: 171,099,343 (GRCm39) T36A possibly damaging Het
Bbx A G 16: 50,020,777 (GRCm39) V799A probably damaging Het
Bud23 T C 5: 135,092,779 (GRCm39) probably null Het
Cnga2 T A X: 71,049,733 (GRCm39) F133I possibly damaging Het
Crispld1 A G 1: 17,823,102 (GRCm39) T390A probably benign Het
Cyp4f39 T A 17: 32,702,428 (GRCm39) D308E probably damaging Het
Dnah6 A G 6: 73,015,729 (GRCm39) V3584A probably damaging Het
Ecpas A G 4: 58,820,086 (GRCm39) probably benign Het
Frk T C 10: 34,484,377 (GRCm39) I450T probably benign Het
Grm6 T C 11: 50,750,816 (GRCm39) S660P probably damaging Het
Hao2 T A 3: 98,789,341 (GRCm39) I116F probably damaging Het
Hyi G A 4: 118,219,674 (GRCm39) G237D probably damaging Het
Jrkl T C 9: 13,245,376 (GRCm39) N95S probably benign Het
Kifbp A G 10: 62,398,806 (GRCm39) probably benign Het
Nanog T C 6: 122,689,676 (GRCm39) probably null Het
Ngf G A 3: 102,428,015 (GRCm39) D255N probably damaging Het
Nlrp4e A G 7: 23,020,652 (GRCm39) I380V probably benign Het
Or52e7 T C 7: 104,684,510 (GRCm39) F35S probably benign Het
Or6c76b T C 10: 129,692,567 (GRCm39) F60S probably damaging Het
Pcdha3 T C 18: 37,080,404 (GRCm39) V382A probably damaging Het
Pla2g4c T A 7: 13,071,676 (GRCm39) N165K probably benign Het
Rexo5 T C 7: 119,424,800 (GRCm39) I362T probably benign Het
Rpl7a-ps3 G A 15: 36,308,429 (GRCm39) noncoding transcript Het
Rpusd2 T C 2: 118,865,705 (GRCm39) V134A probably damaging Het
Serpina1c T A 12: 103,863,259 (GRCm39) probably null Het
Slc6a19 A T 13: 73,829,836 (GRCm39) I606N probably damaging Het
Smchd1 T C 17: 71,714,230 (GRCm39) T878A probably benign Het
Tas2r143 A G 6: 42,377,628 (GRCm39) M153V probably benign Het
Thrb G T 14: 17,925,640 (GRCm38) M1I probably null Het
Trbc2 A G 6: 41,523,814 (GRCm39) probably benign Het
Trim37 T A 11: 87,087,651 (GRCm39) S587R probably benign Het
Ulbp1 T A 10: 7,397,397 (GRCm39) H151L probably benign Het
Vmn2r54 A T 7: 12,366,199 (GRCm39) L245* probably null Het
Vmn2r78 A C 7: 86,569,959 (GRCm39) probably null Het
Xlr5b T C X: 72,201,504 (GRCm39) probably null Het
Xrcc4 A C 13: 90,140,707 (GRCm39) S167R possibly damaging Het
Zfp994 C T 17: 22,420,541 (GRCm39) C136Y probably damaging Het
Other mutations in Adamts18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01290:Adamts18 APN 8 114,501,575 (GRCm39) missense probably damaging 1.00
IGL01548:Adamts18 APN 8 114,490,931 (GRCm39) missense probably damaging 1.00
IGL01556:Adamts18 APN 8 114,571,741 (GRCm39) missense probably benign 0.01
IGL01833:Adamts18 APN 8 114,469,728 (GRCm39) missense probably benign 0.10
IGL02187:Adamts18 APN 8 114,439,826 (GRCm39) missense possibly damaging 0.93
IGL02551:Adamts18 APN 8 114,425,704 (GRCm39) missense probably damaging 1.00
IGL02756:Adamts18 APN 8 114,440,976 (GRCm39) splice site probably benign
IGL03188:Adamts18 APN 8 114,425,656 (GRCm39) missense probably damaging 1.00
IGL03411:Adamts18 APN 8 114,490,929 (GRCm39) nonsense probably null
G1patch:Adamts18 UTSW 8 114,469,833 (GRCm39) missense probably damaging 1.00
R0119:Adamts18 UTSW 8 114,501,585 (GRCm39) missense possibly damaging 0.94
R0378:Adamts18 UTSW 8 114,469,749 (GRCm39) missense probably damaging 1.00
R0410:Adamts18 UTSW 8 114,440,990 (GRCm39) nonsense probably null
R0480:Adamts18 UTSW 8 114,465,450 (GRCm39) missense possibly damaging 0.93
R0514:Adamts18 UTSW 8 114,465,401 (GRCm39) splice site probably null
R0924:Adamts18 UTSW 8 114,432,028 (GRCm39) splice site probably null
R0930:Adamts18 UTSW 8 114,432,028 (GRCm39) splice site probably null
R1333:Adamts18 UTSW 8 114,431,805 (GRCm39) splice site probably benign
R1441:Adamts18 UTSW 8 114,481,194 (GRCm39) critical splice donor site probably null
R2082:Adamts18 UTSW 8 114,501,965 (GRCm39) missense probably damaging 1.00
R2146:Adamts18 UTSW 8 114,571,635 (GRCm39) missense possibly damaging 0.58
R2371:Adamts18 UTSW 8 114,431,893 (GRCm39) missense probably benign 0.36
R3148:Adamts18 UTSW 8 114,465,490 (GRCm39) missense probably damaging 1.00
R3963:Adamts18 UTSW 8 114,504,443 (GRCm39) missense probably benign 0.00
R4056:Adamts18 UTSW 8 114,464,212 (GRCm39) nonsense probably null
R4608:Adamts18 UTSW 8 114,464,245 (GRCm39) missense probably damaging 1.00
R4624:Adamts18 UTSW 8 114,499,800 (GRCm39) nonsense probably null
R4626:Adamts18 UTSW 8 114,499,800 (GRCm39) nonsense probably null
R4627:Adamts18 UTSW 8 114,499,800 (GRCm39) nonsense probably null
R4628:Adamts18 UTSW 8 114,499,800 (GRCm39) nonsense probably null
R4629:Adamts18 UTSW 8 114,499,800 (GRCm39) nonsense probably null
R4710:Adamts18 UTSW 8 114,433,558 (GRCm39) missense probably damaging 0.98
R4959:Adamts18 UTSW 8 114,463,357 (GRCm39) nonsense probably null
R4973:Adamts18 UTSW 8 114,463,357 (GRCm39) nonsense probably null
R4976:Adamts18 UTSW 8 114,425,642 (GRCm39) missense probably benign 0.31
R5119:Adamts18 UTSW 8 114,425,642 (GRCm39) missense probably benign 0.31
R5141:Adamts18 UTSW 8 114,501,902 (GRCm39) missense probably damaging 1.00
R5422:Adamts18 UTSW 8 114,425,606 (GRCm39) missense probably benign 0.06
R5587:Adamts18 UTSW 8 114,501,992 (GRCm39) nonsense probably null
R5868:Adamts18 UTSW 8 114,504,380 (GRCm39) missense possibly damaging 0.69
R5893:Adamts18 UTSW 8 114,499,709 (GRCm39) missense probably damaging 1.00
R5906:Adamts18 UTSW 8 114,436,251 (GRCm39) missense probably benign 0.00
R5942:Adamts18 UTSW 8 114,504,380 (GRCm39) missense probably benign 0.01
R6006:Adamts18 UTSW 8 114,433,606 (GRCm39) missense probably damaging 1.00
R6608:Adamts18 UTSW 8 114,501,911 (GRCm39) missense probably damaging 1.00
R6725:Adamts18 UTSW 8 114,469,833 (GRCm39) missense probably damaging 1.00
R7002:Adamts18 UTSW 8 114,501,922 (GRCm39) missense possibly damaging 0.69
R7276:Adamts18 UTSW 8 114,501,896 (GRCm39) missense probably damaging 0.99
R7292:Adamts18 UTSW 8 114,436,277 (GRCm39) missense probably benign 0.00
R7411:Adamts18 UTSW 8 114,504,362 (GRCm39) missense probably damaging 0.99
R7685:Adamts18 UTSW 8 114,439,855 (GRCm39) missense probably damaging 1.00
R7737:Adamts18 UTSW 8 114,463,566 (GRCm39) splice site probably null
R7860:Adamts18 UTSW 8 114,501,908 (GRCm39) missense probably damaging 1.00
R7936:Adamts18 UTSW 8 114,493,760 (GRCm39) missense probably damaging 1.00
R8197:Adamts18 UTSW 8 114,481,227 (GRCm39) missense probably damaging 1.00
R8363:Adamts18 UTSW 8 114,493,795 (GRCm39) missense probably damaging 1.00
R8759:Adamts18 UTSW 8 114,433,624 (GRCm39) missense probably damaging 1.00
R8934:Adamts18 UTSW 8 114,463,510 (GRCm39) missense possibly damaging 0.90
R9405:Adamts18 UTSW 8 114,430,030 (GRCm39) missense probably damaging 1.00
R9422:Adamts18 UTSW 8 114,501,910 (GRCm39) missense probably damaging 1.00
R9450:Adamts18 UTSW 8 114,490,942 (GRCm39) missense probably benign 0.10
R9475:Adamts18 UTSW 8 114,504,570 (GRCm39) missense possibly damaging 0.93
Z1088:Adamts18 UTSW 8 114,502,072 (GRCm39) missense possibly damaging 0.86
Z1176:Adamts18 UTSW 8 114,469,800 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TCGTGATCCAACTTCAGCCG -3'
(R):5'- ATACCAGAATGCTGATTGACCC -3'

Sequencing Primer
(F):5'- GTGATCCAACTTCAGCCGTTTTTC -3'
(R):5'- TGATTGACCCCAAACTAAGCTGGG -3'
Posted On 2015-07-21