Incidental Mutation 'R4486:Cyp4f39'
ID331637
Institutional Source Beutler Lab
Gene Symbol Cyp4f39
Ensembl Gene ENSMUSG00000061126
Gene Namecytochrome P450, family 4, subfamily f, polypeptide 39
Synonyms4732474A20Rik
MMRRC Submission 041742-MU
Accession Numbers

Genbank: NM_177307; MGI: 2445210

Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R4486 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location32468462-32492479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32483454 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 308 (D308E)
Ref Sequence ENSEMBL: ENSMUSP00000003413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003413]
Predicted Effect probably damaging
Transcript: ENSMUST00000003413
AA Change: D308E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000003413
Gene: ENSMUSG00000061126
AA Change: D308E

DomainStartEndE-ValueType
transmembrane domain 18 40 N/A INTRINSIC
Pfam:p450 60 525 5.8e-124 PFAM
Meta Mutation Damage Score 0.7308 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This gene is part of a cluster of cytochrome P450 genes on chromosome 19 and encodes an enzyme thought to play a role in the 12(R)-lipoxygenase pathway. Mutations in this gene are the cause of ichthyosis lamellar type 3. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 A G 15: 91,178,283 V484A probably damaging Het
Adam22 A T 5: 8,180,227 probably benign Het
Adamts18 G T 8: 113,713,193 P923T probably benign Het
AI314180 A G 4: 58,820,086 probably benign Het
Ank3 C T 10: 70,001,974 T1604I possibly damaging Het
Armc10 A G 5: 21,653,434 Q159R probably damaging Het
Arnt2 T A 7: 84,275,345 T425S probably benign Het
B4galt3 A G 1: 171,271,773 T36A possibly damaging Het
Bbx A G 16: 50,200,414 V799A probably damaging Het
Bud23 T C 5: 135,063,925 probably null Het
Cnga2 T A X: 72,006,127 F133I possibly damaging Het
Crispld1 A G 1: 17,752,878 T390A probably benign Het
Dnah6 A G 6: 73,038,746 V3584A probably damaging Het
Frk T C 10: 34,608,381 I450T probably benign Het
Grm6 T C 11: 50,859,989 S660P probably damaging Het
Hao2 T A 3: 98,882,025 I116F probably damaging Het
Hyi G A 4: 118,362,477 G237D probably damaging Het
Jrkl T C 9: 13,245,371 N95S probably benign Het
Kif1bp A G 10: 62,563,027 probably benign Het
Nanog T C 6: 122,712,717 probably null Het
Ngf G A 3: 102,520,699 D255N probably damaging Het
Nlrp4e A G 7: 23,321,227 I380V probably benign Het
Olfr676 T C 7: 105,035,303 F35S probably benign Het
Olfr813 T C 10: 129,856,698 F60S probably damaging Het
Pcdha3 T C 18: 36,947,351 V382A probably damaging Het
Pla2g4c T A 7: 13,337,751 N165K probably benign Het
Rexo5 T C 7: 119,825,577 I362T probably benign Het
Rpl7a-ps3 G A 15: 36,308,283 noncoding transcript Het
Rpusd2 T C 2: 119,035,224 V134A probably damaging Het
Serpina1c T A 12: 103,897,000 probably null Het
Slc6a19 A T 13: 73,681,717 I606N probably damaging Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Tas2r143 A G 6: 42,400,694 M153V probably benign Het
Thrb G T 14: 17,925,640 M1I probably null Het
Trbc2 A G 6: 41,546,880 probably benign Het
Trim37 T A 11: 87,196,825 S587R probably benign Het
Ulbp1 T A 10: 7,447,397 H151L probably benign Het
Vmn2r54 A T 7: 12,632,272 L245* probably null Het
Vmn2r78 A C 7: 86,920,751 probably null Het
Xlr5b T C X: 73,157,898 probably null Het
Xrcc4 A C 13: 89,992,588 S167R possibly damaging Het
Zfp994 C T 17: 22,201,560 C136Y probably damaging Het
Other mutations in Cyp4f39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00789:Cyp4f39 APN 17 32470912 missense probably damaging 1.00
IGL00822:Cyp4f39 APN 17 32470832 missense probably benign 0.03
IGL00857:Cyp4f39 APN 17 32489657 missense probably benign 0.08
IGL01380:Cyp4f39 APN 17 32481858 missense probably damaging 1.00
IGL01532:Cyp4f39 APN 17 32470954 splice site probably benign
IGL01756:Cyp4f39 APN 17 32483441 nonsense probably null
IGL02090:Cyp4f39 APN 17 32470958 splice site probably benign
IGL02477:Cyp4f39 APN 17 32489645 missense probably benign 0.40
IGL02824:Cyp4f39 APN 17 32468685 critical splice donor site probably null
N/A:Cyp4f39 UTSW 17 32468681 missense probably benign 0.03
R0145:Cyp4f39 UTSW 17 32486960 missense possibly damaging 0.92
R0288:Cyp4f39 UTSW 17 32492436 missense probably benign 0.01
R1676:Cyp4f39 UTSW 17 32482202 missense probably benign 0.41
R1677:Cyp4f39 UTSW 17 32492330 missense probably benign 0.30
R1874:Cyp4f39 UTSW 17 32483324 missense probably damaging 1.00
R1920:Cyp4f39 UTSW 17 32483291 missense probably benign 0.00
R2049:Cyp4f39 UTSW 17 32482138 missense probably benign 0.41
R2139:Cyp4f39 UTSW 17 32491189 missense probably benign 0.01
R2212:Cyp4f39 UTSW 17 32487063 missense possibly damaging 0.62
R3416:Cyp4f39 UTSW 17 32489742 missense possibly damaging 0.72
R3417:Cyp4f39 UTSW 17 32489742 missense possibly damaging 0.72
R5023:Cyp4f39 UTSW 17 32481104 missense probably damaging 1.00
R5523:Cyp4f39 UTSW 17 32470833 missense probably benign 0.10
R5714:Cyp4f39 UTSW 17 32481825 missense probably damaging 1.00
R6010:Cyp4f39 UTSW 17 32482186 missense probably damaging 0.99
R6312:Cyp4f39 UTSW 17 32483294 missense probably benign 0.00
R6477:Cyp4f39 UTSW 17 32481817 missense probably damaging 0.99
R6950:Cyp4f39 UTSW 17 32492306 missense probably damaging 1.00
R7228:Cyp4f39 UTSW 17 32491829 missense probably damaging 1.00
R7311:Cyp4f39 UTSW 17 32489655 missense probably damaging 1.00
R7341:Cyp4f39 UTSW 17 32486954 missense probably damaging 1.00
R7345:Cyp4f39 UTSW 17 32486779 missense probably damaging 1.00
R7405:Cyp4f39 UTSW 17 32481815 missense probably benign 0.01
R7522:Cyp4f39 UTSW 17 32486972 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACCGCTTGCATCACTACC -3'
(R):5'- GTTTCACAGGACAAACCACATG -3'

Sequencing Primer
(F):5'- GCATCACTACCTGGATTTCATG -3'
(R):5'- AACCACATGCTAGACTATAATTACAC -3'
Posted On2015-07-21