Incidental Mutation 'R0099:Nol8'
ID 33164
Institutional Source Beutler Lab
Gene Symbol Nol8
Ensembl Gene ENSMUSG00000021392
Gene Name nucleolar protein 8
Synonyms 5730412B09Rik, D13Ertd548e, 4921532D18Rik
MMRRC Submission 038385-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0099 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 13
Chromosomal Location 49653078-49679016 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 49672689 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 995 (V995A)
Ref Sequence ENSEMBL: ENSMUSP00000152878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021824] [ENSMUST00000221142] [ENSMUST00000222197] [ENSMUST00000223467]
AlphaFold Q3UHX0
Predicted Effect probably benign
Transcript: ENSMUST00000021824
AA Change: V1013A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021824
Gene: ENSMUSG00000021392
AA Change: V1013A

DomainStartEndE-ValueType
RRM 27 103 3.02e-9 SMART
low complexity region 315 327 N/A INTRINSIC
low complexity region 454 468 N/A INTRINSIC
low complexity region 712 724 N/A INTRINSIC
low complexity region 804 816 N/A INTRINSIC
low complexity region 836 849 N/A INTRINSIC
coiled coil region 886 916 N/A INTRINSIC
coiled coil region 955 981 N/A INTRINSIC
low complexity region 1080 1093 N/A INTRINSIC
low complexity region 1152 1164 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221142
AA Change: V995A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221328
Predicted Effect probably benign
Transcript: ENSMUST00000222197
AA Change: V1013A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223346
Predicted Effect probably benign
Transcript: ENSMUST00000223467
AA Change: V995A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NOL8 binds Ras-related GTP-binding proteins (see MIM 608267) and plays a role in cell growth (Sekiguchi et al., 2004 [PubMed 14660641]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930018M24Rik C T 14: 50,896,722 probably benign Het
Acad10 A C 5: 121,621,290 D1043E probably damaging Het
Adamtsl4 C T 3: 95,684,139 G173R probably benign Het
Astn1 G T 1: 158,502,151 S192I probably damaging Het
Atg2a T A 19: 6,252,789 V1010E probably damaging Het
C130079G13Rik A C 3: 59,936,435 K183N probably benign Het
Col11a2 A G 17: 34,049,674 E311G probably damaging Het
Col4a3 A C 1: 82,717,993 E1638A probably benign Het
Cstf2t A G 19: 31,083,831 R256G probably benign Het
Cyp4a12a T C 4: 115,326,672 L225P probably damaging Het
Diexf A G 1: 193,128,470 L75P probably damaging Het
Dnah5 G A 15: 28,239,934 R479H probably damaging Het
Dsg3 A G 18: 20,540,022 I917V probably benign Het
Fam76a G T 4: 132,910,787 probably benign Het
Fras1 T A 5: 96,614,917 probably null Het
Gli1 A G 10: 127,336,006 V293A probably damaging Het
Gm10782 T A 13: 56,363,143 noncoding transcript Het
Greb1l A G 18: 10,509,158 E490G probably damaging Het
Hydin G A 8: 110,589,561 G4362R probably damaging Het
Ica1 A T 6: 8,749,778 probably benign Het
Ikzf4 T A 10: 128,634,197 I485F probably damaging Het
Irf5 A G 6: 29,533,967 T34A probably damaging Het
Krt81 A T 15: 101,463,521 C59* probably null Het
Kynu T A 2: 43,629,053 probably null Het
Ly6g6c T C 17: 35,068,915 V61A probably damaging Het
Manea A C 4: 26,328,104 I312M probably damaging Het
Micall1 G T 15: 79,131,901 probably benign Het
Mthfs A T 9: 89,226,163 probably benign Het
Myh4 A G 11: 67,259,347 T1877A probably benign Het
Myo3a T C 2: 22,245,598 I92T probably benign Het
Nepn A G 10: 52,401,085 S306G probably damaging Het
Olfr1453 A G 19: 13,027,801 F176S probably damaging Het
Olfr1458 T A 19: 13,103,140 T49S probably benign Het
Olfr160 A T 9: 37,711,454 V275E probably damaging Het
Olfr967 A G 9: 39,750,661 I92V possibly damaging Het
Pde1a T A 2: 79,868,313 probably null Het
Phf14 A G 6: 11,987,697 probably benign Het
Plekhh2 C T 17: 84,591,672 Q1026* probably null Het
Polr2b T A 5: 77,320,950 probably benign Het
Ppp1r36 G T 12: 76,436,282 probably null Het
Prdm14 A T 1: 13,118,945 C392S probably damaging Het
Rabgap1l A G 1: 160,682,116 S436P possibly damaging Het
Rfc2 A T 5: 134,595,281 probably null Het
Rfx4 A T 10: 84,894,304 M437L probably benign Het
Rgs17 T A 10: 5,842,583 R74S probably benign Het
Rnf139 C A 15: 58,899,415 L430I probably damaging Het
Sgsm1 C A 5: 113,274,360 probably benign Het
Skint6 T A 4: 112,811,501 T1126S possibly damaging Het
Slc15a2 T C 16: 36,753,036 E602G probably damaging Het
Stpg2 T C 3: 139,243,193 probably benign Het
Sycp2l T C 13: 41,129,525 probably benign Het
Tlr11 A T 14: 50,360,818 N87I probably benign Het
Tril A G 6: 53,818,363 F625L probably damaging Het
Ube3c T A 5: 29,607,064 V434E probably damaging Het
Usp34 G A 11: 23,363,111 G533R probably damaging Het
Zfp93 G T 7: 24,275,475 R295L probably benign Het
Other mutations in Nol8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Nol8 APN 13 49662228 missense probably benign 0.01
IGL01106:Nol8 APN 13 49654481 missense possibly damaging 0.46
IGL01413:Nol8 APN 13 49659952 missense possibly damaging 0.82
IGL01540:Nol8 APN 13 49661670 missense probably benign 0.06
IGL01670:Nol8 APN 13 49661308 missense possibly damaging 0.54
IGL01672:Nol8 APN 13 49675407 missense possibly damaging 0.95
IGL02032:Nol8 APN 13 49672772 missense probably benign
IGL02212:Nol8 APN 13 49662150 missense possibly damaging 0.87
IGL02323:Nol8 APN 13 49655245 splice site probably benign
IGL02645:Nol8 APN 13 49665471 critical splice donor site probably null
IGL02949:Nol8 APN 13 49662402 missense probably benign 0.01
IGL02954:Nol8 APN 13 49661172 missense probably benign 0.01
IGL03182:Nol8 APN 13 49664081 missense probably damaging 1.00
IGL03406:Nol8 APN 13 49661568 missense probably damaging 1.00
P0047:Nol8 UTSW 13 49654348 splice site probably null
R0092:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R0145:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R0269:Nol8 UTSW 13 49654445 missense possibly damaging 0.49
R0370:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R0374:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R0390:Nol8 UTSW 13 49662152 missense probably damaging 1.00
R0617:Nol8 UTSW 13 49654445 missense possibly damaging 0.49
R0635:Nol8 UTSW 13 49676758 missense probably benign 0.05
R0637:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R1246:Nol8 UTSW 13 49676769 missense probably damaging 1.00
R1446:Nol8 UTSW 13 49655227 missense probably damaging 1.00
R1464:Nol8 UTSW 13 49676788 missense probably benign
R1464:Nol8 UTSW 13 49676788 missense probably benign
R1627:Nol8 UTSW 13 49661504 missense probably benign 0.01
R1703:Nol8 UTSW 13 49667457 missense possibly damaging 0.65
R1751:Nol8 UTSW 13 49667408 missense probably benign 0.06
R2187:Nol8 UTSW 13 49661999 missense probably benign 0.00
R2357:Nol8 UTSW 13 49654504 critical splice donor site probably null
R3081:Nol8 UTSW 13 49678392 unclassified probably benign
R3969:Nol8 UTSW 13 49660016 nonsense probably null
R4199:Nol8 UTSW 13 49661748 missense possibly damaging 0.65
R4720:Nol8 UTSW 13 49662753 missense probably damaging 1.00
R4927:Nol8 UTSW 13 49654425 missense possibly damaging 0.79
R5177:Nol8 UTSW 13 49661112 missense probably benign 0.32
R5512:Nol8 UTSW 13 49676787 missense probably benign
R5744:Nol8 UTSW 13 49662326 missense possibly damaging 0.82
R5988:Nol8 UTSW 13 49672614 missense possibly damaging 0.58
R6048:Nol8 UTSW 13 49653684 critical splice donor site probably null
R6306:Nol8 UTSW 13 49676353 missense probably damaging 1.00
R6359:Nol8 UTSW 13 49664070 missense probably benign 0.16
R6378:Nol8 UTSW 13 49667355 missense probably damaging 1.00
R6655:Nol8 UTSW 13 49654392 missense probably damaging 1.00
R7035:Nol8 UTSW 13 49661202 missense probably benign 0.06
R7058:Nol8 UTSW 13 49676386 missense probably damaging 1.00
R7368:Nol8 UTSW 13 49661219 missense probably benign 0.00
R7450:Nol8 UTSW 13 49660015 missense probably benign 0.01
R7673:Nol8 UTSW 13 49664780 missense probably benign 0.15
R7750:Nol8 UTSW 13 49662266 missense possibly damaging 0.83
R8246:Nol8 UTSW 13 49655248 splice site probably benign
R9081:Nol8 UTSW 13 49661405 missense probably benign 0.00
R9127:Nol8 UTSW 13 49661999 missense probably benign 0.00
R9223:Nol8 UTSW 13 49661262 missense possibly damaging 0.63
X0020:Nol8 UTSW 13 49661165 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGTATGTCTTTCAGTAAGGCAACACGG -3'
(R):5'- TGTCTAGCCTCTACTCATACAGCAGC -3'

Sequencing Primer
(F):5'- TCAGTAAGGCAACACGGAAGAAG -3'
(R):5'- AGCAGTCTGCTGCCTCTAAAG -3'
Posted On 2013-05-09