Incidental Mutation 'R4487:Raph1'
ID 331644
Institutional Source Beutler Lab
Gene Symbol Raph1
Ensembl Gene ENSMUSG00000026014
Gene Name Ras association (RalGDS/AF-6) and pleckstrin homology domains 1
Synonyms C730009O10Rik, Lpd, 9430025M21Rik, lamellipodin
MMRRC Submission 041743-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.136) question?
Stock # R4487 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 60482292-60567104 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 60502869 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 362 (S362N)
Ref Sequence ENSEMBL: ENSMUSP00000027168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027168] [ENSMUST00000090293] [ENSMUST00000140485]
AlphaFold F2Z3U3
Predicted Effect possibly damaging
Transcript: ENSMUST00000027168
AA Change: S362N

PolyPhen 2 Score 0.684 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000027168
Gene: ENSMUSG00000026014
AA Change: S362N

DomainStartEndE-ValueType
low complexity region 201 218 N/A INTRINSIC
low complexity region 294 308 N/A INTRINSIC
RA 322 408 1.63e-13 SMART
PH 450 560 3.38e-11 SMART
low complexity region 581 604 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090293
AA Change: S362N

PolyPhen 2 Score 0.242 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000087763
Gene: ENSMUSG00000026014
AA Change: S362N

DomainStartEndE-ValueType
low complexity region 201 218 N/A INTRINSIC
low complexity region 294 308 N/A INTRINSIC
RA 322 408 1.63e-13 SMART
PH 450 560 3.38e-11 SMART
low complexity region 581 604 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000140485
AA Change: S310N
SMART Domains Protein: ENSMUSP00000121023
Gene: ENSMUSG00000026014
AA Change: S310N

DomainStartEndE-ValueType
low complexity region 201 218 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
RA 270 356 1.63e-13 SMART
PH 398 508 3.38e-11 SMART
low complexity region 529 552 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189383
Meta Mutation Damage Score 0.0916 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Mig10/Rap1-interacting adaptor molecule/Lamellipodin family of adapter proteins, which function in cell migration. Members of this family contain pleckstrin-homology domains, Ras-association domains, and proline-rich C-termini. The protein encoded by this gene regulates actin dynamics through interaction with Ena/Vasodilator proteins as well as direct binding to filamentous actin to regulate actin network assembly. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a conditional allele activated in all cells exhibit background sensitive neonatal or postnatal lethality, decreased body size, belly spotting and decreased melanocyte numbers in the trunk. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310030G06Rik A G 9: 50,740,631 L99P probably damaging Het
Abcd2 A G 15: 91,178,283 V484A probably damaging Het
Adgrv1 A G 13: 81,440,066 I4467T probably damaging Het
Ash1l T A 3: 88,985,315 D1500E possibly damaging Het
BC017158 T C 7: 128,288,358 D24G probably damaging Het
C1ql2 A T 1: 120,341,680 Y188F possibly damaging Het
Cnga2 T A X: 72,006,127 F133I possibly damaging Het
Crybg2 T C 4: 134,074,201 S891P probably benign Het
Hao2 T A 3: 98,882,025 I116F probably damaging Het
Htr1b A T 9: 81,631,539 D338E probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif9 A G 9: 110,494,484 E225G probably null Het
Krt76 T C 15: 101,890,482 K256R possibly damaging Het
Mapk4 T C 18: 73,930,975 D392G probably damaging Het
Mthfr A G 4: 148,051,427 K278R probably benign Het
Mup4 T A 4: 59,960,547 E18V probably damaging Het
Nepro A G 16: 44,735,726 K416E probably damaging Het
Ngf G A 3: 102,520,699 D255N probably damaging Het
Nmu A G 5: 76,344,062 probably null Het
Nt5m A G 11: 59,848,347 Y73C probably damaging Het
Oaz3 A T 3: 94,435,130 probably null Het
Pgap1 A G 1: 54,528,592 S365P probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pus7l A G 15: 94,531,617 I440T possibly damaging Het
Rftn2 A G 1: 55,202,152 Y330H possibly damaging Het
Rhot2 G A 17: 25,839,493 H580Y probably benign Het
Rnase2a A T 14: 51,255,845 M21K unknown Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Snx1 A T 9: 66,089,595 V459E possibly damaging Het
Suz12 A G 11: 80,032,113 T694A probably benign Het
Tg G A 15: 66,671,396 C53Y probably damaging Het
Tor1aip1 G T 1: 156,007,124 T326K probably damaging Het
Vmn1r61 C A 7: 5,610,925 C130F possibly damaging Het
Xlr5b T C X: 73,157,898 probably null Het
Other mutations in Raph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02300:Raph1 APN 1 60525947 missense possibly damaging 0.76
IGL02900:Raph1 APN 1 60502863 missense probably damaging 1.00
FR4976:Raph1 UTSW 1 60489267 intron probably benign
R0048:Raph1 UTSW 1 60500605 missense probably benign 0.03
R0048:Raph1 UTSW 1 60500605 missense probably benign 0.03
R0049:Raph1 UTSW 1 60525899 missense probably benign 0.03
R0049:Raph1 UTSW 1 60525899 missense probably benign 0.03
R0227:Raph1 UTSW 1 60525977 missense probably benign 0.00
R0387:Raph1 UTSW 1 60510496 intron probably benign
R0607:Raph1 UTSW 1 60525869 missense probably damaging 1.00
R1740:Raph1 UTSW 1 60519024 nonsense probably null
R2274:Raph1 UTSW 1 60498500 missense probably damaging 1.00
R3108:Raph1 UTSW 1 60493386 missense probably benign 0.01
R3977:Raph1 UTSW 1 60498523 missense probably benign 0.39
R4260:Raph1 UTSW 1 60502965 missense possibly damaging 0.94
R4721:Raph1 UTSW 1 60503001 unclassified probably benign
R4782:Raph1 UTSW 1 60489114 missense probably damaging 1.00
R5027:Raph1 UTSW 1 60496277 missense probably damaging 1.00
R5037:Raph1 UTSW 1 60496222 splice site probably null
R5106:Raph1 UTSW 1 60533300 missense probably damaging 1.00
R5506:Raph1 UTSW 1 60493498 intron probably benign
R5510:Raph1 UTSW 1 60522946 unclassified probably benign
R5587:Raph1 UTSW 1 60498473 missense probably damaging 1.00
R5591:Raph1 UTSW 1 60501746 unclassified probably benign
R5619:Raph1 UTSW 1 60490255 intron probably benign
R5776:Raph1 UTSW 1 60490156 intron probably benign
R5802:Raph1 UTSW 1 60488673 missense possibly damaging 0.81
R6742:Raph1 UTSW 1 60525720 missense probably damaging 0.97
R7122:Raph1 UTSW 1 60525977 missense probably benign 0.10
R7219:Raph1 UTSW 1 60502873 missense unknown
R7251:Raph1 UTSW 1 60489868 missense unknown
R7254:Raph1 UTSW 1 60499608 missense unknown
R7732:Raph1 UTSW 1 60533288 missense possibly damaging 0.82
R7979:Raph1 UTSW 1 60525989 missense probably benign 0.00
R7986:Raph1 UTSW 1 60496286 missense
R8167:Raph1 UTSW 1 60490111 missense unknown
R8168:Raph1 UTSW 1 60499620 missense unknown
R8399:Raph1 UTSW 1 60489318 missense unknown
R9036:Raph1 UTSW 1 60502965 missense unknown
R9146:Raph1 UTSW 1 60518978 critical splice donor site probably null
R9338:Raph1 UTSW 1 60490141 missense unknown
R9381:Raph1 UTSW 1 60501800 missense unknown
R9383:Raph1 UTSW 1 60525670 missense unknown
R9399:Raph1 UTSW 1 60525995 missense probably benign
R9454:Raph1 UTSW 1 60489594 missense unknown
R9561:Raph1 UTSW 1 60525728 missense possibly damaging 0.49
RF018:Raph1 UTSW 1 60489267 intron probably benign
RF022:Raph1 UTSW 1 60489267 intron probably benign
Predicted Primers PCR Primer
(F):5'- TCAAAGAACTCTCCAGATAGACTAGG -3'
(R):5'- CTGTAGTAGTAGTGTCAGAGTAGTC -3'

Sequencing Primer
(F):5'- ACTCTCCAGATAGACTAGGAAAAAC -3'
(R):5'- GGTCCACATGTCTGATGA -3'
Posted On 2015-07-21