Incidental Mutation 'R4487:Tor1aip1'
ID331646
Institutional Source Beutler Lab
Gene Symbol Tor1aip1
Ensembl Gene ENSMUSG00000026466
Gene Nametorsin A interacting protein 1
SynonymsLAP1
MMRRC Submission 041743-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4487 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location156004599-156036480 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 156007124 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 326 (T326K)
Ref Sequence ENSEMBL: ENSMUSP00000126751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027738] [ENSMUST00000097527] [ENSMUST00000130995] [ENSMUST00000136331] [ENSMUST00000136397] [ENSMUST00000141878] [ENSMUST00000169241]
Predicted Effect probably damaging
Transcript: ENSMUST00000027738
AA Change: T455K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027738
Gene: ENSMUSG00000026466
AA Change: T455K

DomainStartEndE-ValueType
low complexity region 107 121 N/A INTRINSIC
Pfam:LAP1C 122 265 9.1e-36 PFAM
Pfam:LAP1C 257 520 6.7e-171 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097527
AA Change: T511K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095134
Gene: ENSMUSG00000026466
AA Change: T511K

DomainStartEndE-ValueType
low complexity region 107 121 N/A INTRINSIC
low complexity region 149 167 N/A INTRINSIC
Pfam:LAP1C 244 576 1.9e-165 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130995
SMART Domains Protein: ENSMUSP00000141619
Gene: ENSMUSG00000026466

DomainStartEndE-ValueType
low complexity region 107 121 N/A INTRINSIC
Pfam:LAP1C 122 273 3.8e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136331
SMART Domains Protein: ENSMUSP00000137617
Gene: ENSMUSG00000026466

DomainStartEndE-ValueType
low complexity region 107 121 N/A INTRINSIC
Pfam:LAP1C 122 283 8.4e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136397
SMART Domains Protein: ENSMUSP00000118654
Gene: ENSMUSG00000026466

DomainStartEndE-ValueType
Pfam:LAP1C 1 77 5.6e-15 PFAM
Pfam:LAP1C 74 190 5.7e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141878
SMART Domains Protein: ENSMUSP00000123391
Gene: ENSMUSG00000026466

DomainStartEndE-ValueType
Pfam:LAP1C 1 176 1.4e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169241
AA Change: T326K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126751
Gene: ENSMUSG00000026466
AA Change: T326K

DomainStartEndE-ValueType
Pfam:LAP1C 1 77 1.6e-14 PFAM
Pfam:LAP1C 75 391 2.4e-195 PFAM
Meta Mutation Damage Score 0.3330 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type 2 integral membrane protein that binds A- and B-type lamins. The encoded protein localizes to the inner nuclear membrane and may be involved in maintaining the attachment of the nuclear membrane to the nuclear lamina during cell division. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit perinatal lethality and nuclear membrane blebs in neural and nonneural tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310030G06Rik A G 9: 50,740,631 L99P probably damaging Het
Abcd2 A G 15: 91,178,283 V484A probably damaging Het
Adgrv1 A G 13: 81,440,066 I4467T probably damaging Het
Ash1l T A 3: 88,985,315 D1500E possibly damaging Het
BC017158 T C 7: 128,288,358 D24G probably damaging Het
C1ql2 A T 1: 120,341,680 Y188F possibly damaging Het
Cnga2 T A X: 72,006,127 F133I possibly damaging Het
Crybg2 T C 4: 134,074,201 S891P probably benign Het
Hao2 T A 3: 98,882,025 I116F probably damaging Het
Htr1b A T 9: 81,631,539 D338E probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif9 A G 9: 110,494,484 E225G probably null Het
Krt76 T C 15: 101,890,482 K256R possibly damaging Het
Mapk4 T C 18: 73,930,975 D392G probably damaging Het
Mthfr A G 4: 148,051,427 K278R probably benign Het
Mup4 T A 4: 59,960,547 E18V probably damaging Het
Nepro A G 16: 44,735,726 K416E probably damaging Het
Ngf G A 3: 102,520,699 D255N probably damaging Het
Nmu A G 5: 76,344,062 probably null Het
Nt5m A G 11: 59,848,347 Y73C probably damaging Het
Oaz3 A T 3: 94,435,130 probably null Het
Pgap1 A G 1: 54,528,592 S365P probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pus7l A G 15: 94,531,617 I440T possibly damaging Het
Raph1 C T 1: 60,502,869 S362N possibly damaging Het
Rftn2 A G 1: 55,202,152 Y330H possibly damaging Het
Rhot2 G A 17: 25,839,493 H580Y probably benign Het
Rnase2a A T 14: 51,255,845 M21K unknown Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Snx1 A T 9: 66,089,595 V459E possibly damaging Het
Suz12 A G 11: 80,032,113 T694A probably benign Het
Tg G A 15: 66,671,396 C53Y probably damaging Het
Vmn1r61 C A 7: 5,610,925 C130F possibly damaging Het
Xlr5b T C X: 73,157,898 probably null Het
Other mutations in Tor1aip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Tor1aip1 APN 1 156031467 missense probably benign 0.01
IGL00837:Tor1aip1 APN 1 156006916 utr 3 prime probably benign
IGL02573:Tor1aip1 APN 1 156013371 missense probably damaging 0.99
IGL02815:Tor1aip1 APN 1 156035916 missense probably damaging 1.00
IGL02964:Tor1aip1 APN 1 156035844 missense probably damaging 0.96
IGL03128:Tor1aip1 APN 1 156007035 missense probably damaging 1.00
R0100:Tor1aip1 UTSW 1 156007075 missense probably damaging 1.00
R0319:Tor1aip1 UTSW 1 156007181 missense probably damaging 1.00
R0410:Tor1aip1 UTSW 1 156035940 missense possibly damaging 0.85
R0458:Tor1aip1 UTSW 1 156030407 missense probably damaging 0.99
R0506:Tor1aip1 UTSW 1 156007674 nonsense probably null
R0563:Tor1aip1 UTSW 1 156035808 missense probably damaging 1.00
R1696:Tor1aip1 UTSW 1 156017516 missense possibly damaging 0.67
R1745:Tor1aip1 UTSW 1 156030434 splice site probably null
R1830:Tor1aip1 UTSW 1 156007562 missense probably damaging 1.00
R2132:Tor1aip1 UTSW 1 156007562 missense probably damaging 1.00
R5613:Tor1aip1 UTSW 1 156033753 missense probably damaging 0.98
R5657:Tor1aip1 UTSW 1 156007488 missense probably damaging 1.00
R6123:Tor1aip1 UTSW 1 156007205 missense probably damaging 1.00
R6380:Tor1aip1 UTSW 1 156018488 missense possibly damaging 0.85
R6647:Tor1aip1 UTSW 1 156018253 missense possibly damaging 0.94
R6852:Tor1aip1 UTSW 1 156035820 missense probably damaging 0.99
R7354:Tor1aip1 UTSW 1 156036113 missense probably damaging 0.98
R7463:Tor1aip1 UTSW 1 156007609 missense possibly damaging 0.48
R7615:Tor1aip1 UTSW 1 156007584 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGCCTGCTTTCAGAGTGTTC -3'
(R):5'- CAGGTAAAGCTGCTCAGGAC -3'

Sequencing Primer
(F):5'- TCAGAGTGTTCTCAGGCTGCAC -3'
(R):5'- GACCTCGTTAAGCATGAAGTCGATC -3'
Posted On2015-07-21