Incidental Mutation 'R4487:Oaz3'
ID331650
Institutional Source Beutler Lab
Gene Symbol Oaz3
Ensembl Gene ENSMUSG00000028141
Gene Nameornithine decarboxylase antizyme 3
SynonymsAZ-3, Oaz-t, antizyme 3, AZ3, ornithine decarboxylase antizyme in testis
MMRRC Submission 041743-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.240) question?
Stock #R4487 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location94432414-94443915 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 94435130 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000045245] [ENSMUST00000166032] [ENSMUST00000191506] [ENSMUST00000196606] [ENSMUST00000197495] [ENSMUST00000197901] [ENSMUST00000199678] [ENSMUST00000203883] [ENSMUST00000204548] [ENSMUST00000204913]
Predicted Effect probably benign
Transcript: ENSMUST00000045245
SMART Domains Protein: ENSMUSP00000041002
Gene: ENSMUSG00000041912

DomainStartEndE-ValueType
transmembrane domain 17 34 N/A INTRINSIC
KH 51 120 9.32e-17 SMART
KH 123 195 3.93e-15 SMART
TUDOR 352 410 2.79e-6 SMART
low complexity region 429 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166032
SMART Domains Protein: ENSMUSP00000129635
Gene: ENSMUSG00000041912

DomainStartEndE-ValueType
transmembrane domain 17 34 N/A INTRINSIC
KH 51 120 9.32e-17 SMART
KH 123 195 3.93e-15 SMART
TUDOR 352 410 2.79e-6 SMART
low complexity region 429 434 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191506
AA Change: V118E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139408
Gene: ENSMUSG00000028141
AA Change: V118E

DomainStartEndE-ValueType
low complexity region 67 88 N/A INTRINSIC
Pfam:ODC_AZ 137 233 1.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196606
SMART Domains Protein: ENSMUSP00000143102
Gene: ENSMUSG00000041912

DomainStartEndE-ValueType
transmembrane domain 17 34 N/A INTRINSIC
KH 51 116 1.5e-11 SMART
KH 119 191 2.4e-17 SMART
TUDOR 348 406 1.7e-8 SMART
low complexity region 425 430 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196799
Predicted Effect probably benign
Transcript: ENSMUST00000197495
SMART Domains Protein: ENSMUSP00000143135
Gene: ENSMUSG00000041912

DomainStartEndE-ValueType
transmembrane domain 17 34 N/A INTRINSIC
KH 51 150 3e-18 SMART
TUDOR 307 365 1.7e-8 SMART
low complexity region 384 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197901
SMART Domains Protein: ENSMUSP00000142561
Gene: ENSMUSG00000041912

DomainStartEndE-ValueType
transmembrane domain 17 34 N/A INTRINSIC
KH 51 120 9.32e-17 SMART
KH 123 195 3.93e-15 SMART
TUDOR 352 410 2.79e-6 SMART
low complexity region 429 434 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199318
Predicted Effect probably damaging
Transcript: ENSMUST00000199678
AA Change: V118E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143080
Gene: ENSMUSG00000028141
AA Change: V118E

DomainStartEndE-ValueType
low complexity region 23 41 N/A INTRINSIC
Pfam:ODC_AZ 90 186 1.3e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203883
AA Change: V73E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145484
Gene: ENSMUSG00000028141
AA Change: V73E

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:ODC_AZ 91 189 4.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204548
SMART Domains Protein: ENSMUSP00000145079
Gene: ENSMUSG00000028141

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204913
SMART Domains Protein: ENSMUSP00000145113
Gene: ENSMUSG00000028141

DomainStartEndE-ValueType
low complexity region 71 89 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000204980
Meta Mutation Damage Score 0.9264 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the ornithine decarboxylase antizyme family, which plays a role in cell growth and proliferation by regulating intracellular polyamine levels. Expression of antizymes requires +1 ribosomal frameshifting, which is enhanced by high levels of polyamines. Antizymes in turn bind to and inhibit ornithine decarboxylase (ODC), the key enzyme in polyamine biosynthesis; thus, completing the auto-regulatory circuit. This gene encodes antizyme 3, the third member of the antizyme family. Like antizymes 1 and 2, antizyme 3 inhibits ODC activity and polyamine uptake; however, it does not stimulate ODC degradation. Also, while antizymes 1 and 2 have broad tissue distribution, expression of antizyme 3 is restricted to haploid germ cells in testis, suggesting a distinct role for this antizyme in spermiogenesis. Antizyme 3 gene knockout studies showed that homozygous mutant male mice were infertile, and indicated the likely role of this antizyme in the formation of a rigid connection between the sperm head and tail during spermatogenesis. This transcript initiates translation from a non-AUG (CUG) codon that is highly conserved among the antizyme 3 orthologs. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit male infertility due to detachment of sperm tail and head during sperm maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310030G06Rik A G 9: 50,740,631 L99P probably damaging Het
Abcd2 A G 15: 91,178,283 V484A probably damaging Het
Adgrv1 A G 13: 81,440,066 I4467T probably damaging Het
Ash1l T A 3: 88,985,315 D1500E possibly damaging Het
BC017158 T C 7: 128,288,358 D24G probably damaging Het
C1ql2 A T 1: 120,341,680 Y188F possibly damaging Het
Cnga2 T A X: 72,006,127 F133I possibly damaging Het
Crybg2 T C 4: 134,074,201 S891P probably benign Het
Hao2 T A 3: 98,882,025 I116F probably damaging Het
Htr1b A T 9: 81,631,539 D338E probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif9 A G 9: 110,494,484 E225G probably null Het
Krt76 T C 15: 101,890,482 K256R possibly damaging Het
Mapk4 T C 18: 73,930,975 D392G probably damaging Het
Mthfr A G 4: 148,051,427 K278R probably benign Het
Mup4 T A 4: 59,960,547 E18V probably damaging Het
Nepro A G 16: 44,735,726 K416E probably damaging Het
Ngf G A 3: 102,520,699 D255N probably damaging Het
Nmu A G 5: 76,344,062 probably null Het
Nt5m A G 11: 59,848,347 Y73C probably damaging Het
Pgap1 A G 1: 54,528,592 S365P probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pus7l A G 15: 94,531,617 I440T possibly damaging Het
Raph1 C T 1: 60,502,869 S362N possibly damaging Het
Rftn2 A G 1: 55,202,152 Y330H possibly damaging Het
Rhot2 G A 17: 25,839,493 H580Y probably benign Het
Rnase2a A T 14: 51,255,845 M21K unknown Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Snx1 A T 9: 66,089,595 V459E possibly damaging Het
Suz12 A G 11: 80,032,113 T694A probably benign Het
Tg G A 15: 66,671,396 C53Y probably damaging Het
Tor1aip1 G T 1: 156,007,124 T326K probably damaging Het
Vmn1r61 C A 7: 5,610,925 C130F possibly damaging Het
Xlr5b T C X: 73,157,898 probably null Het
Other mutations in Oaz3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02931:Oaz3 APN 3 94434980 missense probably benign 0.15
PIT4366001:Oaz3 UTSW 3 94433594 missense unknown
PIT4791001:Oaz3 UTSW 3 94433545 missense unknown
R1004:Oaz3 UTSW 3 94435043 missense probably damaging 1.00
R1833:Oaz3 UTSW 3 94436042 unclassified probably benign
R2230:Oaz3 UTSW 3 94434539 missense probably benign 0.21
R2231:Oaz3 UTSW 3 94434539 missense probably benign 0.21
R2232:Oaz3 UTSW 3 94434539 missense probably benign 0.21
R4776:Oaz3 UTSW 3 94434998 missense probably benign 0.00
R5502:Oaz3 UTSW 3 94435085 missense probably damaging 1.00
R5930:Oaz3 UTSW 3 94436410 missense possibly damaging 0.89
R6212:Oaz3 UTSW 3 94435068 missense probably benign 0.23
R6362:Oaz3 UTSW 3 94434988 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAAATATCCCAACTCTTCCCCATG -3'
(R):5'- GGCACTTCAGTTTGCCTTAGG -3'

Sequencing Primer
(F):5'- ATGCCCATCCAGGTCCTCAC -3'
(R):5'- GTGTGATTTTAGGACAAAATGAGCAC -3'
Posted On2015-07-21