Incidental Mutation 'R4487:Hao2'
ID331651
Institutional Source Beutler Lab
Gene Symbol Hao2
Ensembl Gene ENSMUSG00000027870
Gene Namehydroxyacid oxidase 2
SynonymsHao3
MMRRC Submission 041743-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4487 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location98874521-98893239 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 98882025 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 116 (I116F)
Ref Sequence ENSEMBL: ENSMUSP00000029464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029464]
Predicted Effect probably damaging
Transcript: ENSMUST00000029464
AA Change: I116F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029464
Gene: ENSMUSG00000027870
AA Change: I116F

DomainStartEndE-ValueType
Pfam:FMN_dh 13 350 1.8e-127 PFAM
Pfam:Glu_synthase 258 314 1.1e-6 PFAM
Meta Mutation Damage Score 0.6432 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three related genes that have 2-hydroxyacid oxidase activity. The encoded protein localizes to the peroxisome has the highest activity toward the substrate 2-hydroxypalmitate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Electrophoretic variants are known for this locus in kidney. The a allele determines a slow anodally migrating band in all inbred strains tested; the b allele determines a fast band in M. m. castaneus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310030G06Rik A G 9: 50,740,631 L99P probably damaging Het
Abcd2 A G 15: 91,178,283 V484A probably damaging Het
Adgrv1 A G 13: 81,440,066 I4467T probably damaging Het
Ash1l T A 3: 88,985,315 D1500E possibly damaging Het
BC017158 T C 7: 128,288,358 D24G probably damaging Het
C1ql2 A T 1: 120,341,680 Y188F possibly damaging Het
Cnga2 T A X: 72,006,127 F133I possibly damaging Het
Crybg2 T C 4: 134,074,201 S891P probably benign Het
Htr1b A T 9: 81,631,539 D338E probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif9 A G 9: 110,494,484 E225G probably null Het
Krt76 T C 15: 101,890,482 K256R possibly damaging Het
Mapk4 T C 18: 73,930,975 D392G probably damaging Het
Mthfr A G 4: 148,051,427 K278R probably benign Het
Mup4 T A 4: 59,960,547 E18V probably damaging Het
Nepro A G 16: 44,735,726 K416E probably damaging Het
Ngf G A 3: 102,520,699 D255N probably damaging Het
Nmu A G 5: 76,344,062 probably null Het
Nt5m A G 11: 59,848,347 Y73C probably damaging Het
Oaz3 A T 3: 94,435,130 probably null Het
Pgap1 A G 1: 54,528,592 S365P probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pus7l A G 15: 94,531,617 I440T possibly damaging Het
Raph1 C T 1: 60,502,869 S362N possibly damaging Het
Rftn2 A G 1: 55,202,152 Y330H possibly damaging Het
Rhot2 G A 17: 25,839,493 H580Y probably benign Het
Rnase2a A T 14: 51,255,845 M21K unknown Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Snx1 A T 9: 66,089,595 V459E possibly damaging Het
Suz12 A G 11: 80,032,113 T694A probably benign Het
Tg G A 15: 66,671,396 C53Y probably damaging Het
Tor1aip1 G T 1: 156,007,124 T326K probably damaging Het
Vmn1r61 C A 7: 5,610,925 C130F possibly damaging Het
Xlr5b T C X: 73,157,898 probably null Het
Other mutations in Hao2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:Hao2 APN 3 98880332 splice site probably benign
IGL03279:Hao2 APN 3 98880396 missense possibly damaging 0.88
goatherd UTSW 3 98877135 missense probably benign 0.06
R0600:Hao2 UTSW 3 98883560 splice site probably benign
R1298:Hao2 UTSW 3 98883669 missense possibly damaging 0.94
R3176:Hao2 UTSW 3 98880328 splice site probably benign
R3177:Hao2 UTSW 3 98880328 splice site probably benign
R3786:Hao2 UTSW 3 98876752 missense probably damaging 1.00
R4486:Hao2 UTSW 3 98882025 missense probably damaging 1.00
R4488:Hao2 UTSW 3 98882025 missense probably damaging 1.00
R5290:Hao2 UTSW 3 98877177 missense probably damaging 0.99
R5760:Hao2 UTSW 3 98880432 nonsense probably null
R6129:Hao2 UTSW 3 98880526 missense probably benign 0.00
R6720:Hao2 UTSW 3 98877135 missense probably benign 0.06
R6861:Hao2 UTSW 3 98877182 missense probably damaging 1.00
R6991:Hao2 UTSW 3 98876752 missense probably damaging 1.00
R7203:Hao2 UTSW 3 98877282 splice site probably null
Z1088:Hao2 UTSW 3 98875352 missense probably damaging 1.00
Z1177:Hao2 UTSW 3 98881942 missense probably benign 0.02
Z1177:Hao2 UTSW 3 98882041 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTCCAAATCCAGCAGGCTTC -3'
(R):5'- TAGCTTACACGGAAGAGAATGC -3'

Sequencing Primer
(F):5'- AAATCCAGCAGGCTTCTCTTG -3'
(R):5'- ATCTCTCATGGGGAAGTAGAATGTAC -3'
Posted On2015-07-21