Incidental Mutation 'R4487:Vmn1r61'
ID331657
Institutional Source Beutler Lab
Gene Symbol Vmn1r61
Ensembl Gene ENSMUSG00000094313
Gene Namevomeronasal 1 receptor 61
SynonymsGm7186
MMRRC Submission 041743-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R4487 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location5610251-5612068 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 5610925 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 130 (C130F)
Ref Sequence ENSEMBL: ENSMUSP00000128012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164880]
Predicted Effect possibly damaging
Transcript: ENSMUST00000164880
AA Change: C130F

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000128012
Gene: ENSMUSG00000094313
AA Change: C130F

DomainStartEndE-ValueType
Pfam:TAS2R 1 294 5.3e-12 PFAM
Pfam:7tm_1 20 279 5e-9 PFAM
Pfam:V1R 31 299 9.5e-21 PFAM
Meta Mutation Damage Score 0.4246 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310030G06Rik A G 9: 50,740,631 L99P probably damaging Het
Abcd2 A G 15: 91,178,283 V484A probably damaging Het
Adgrv1 A G 13: 81,440,066 I4467T probably damaging Het
Ash1l T A 3: 88,985,315 D1500E possibly damaging Het
BC017158 T C 7: 128,288,358 D24G probably damaging Het
C1ql2 A T 1: 120,341,680 Y188F possibly damaging Het
Cnga2 T A X: 72,006,127 F133I possibly damaging Het
Crybg2 T C 4: 134,074,201 S891P probably benign Het
Hao2 T A 3: 98,882,025 I116F probably damaging Het
Htr1b A T 9: 81,631,539 D338E probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif9 A G 9: 110,494,484 E225G probably null Het
Krt76 T C 15: 101,890,482 K256R possibly damaging Het
Mapk4 T C 18: 73,930,975 D392G probably damaging Het
Mthfr A G 4: 148,051,427 K278R probably benign Het
Mup4 T A 4: 59,960,547 E18V probably damaging Het
Nepro A G 16: 44,735,726 K416E probably damaging Het
Ngf G A 3: 102,520,699 D255N probably damaging Het
Nmu A G 5: 76,344,062 probably null Het
Nt5m A G 11: 59,848,347 Y73C probably damaging Het
Oaz3 A T 3: 94,435,130 probably null Het
Pgap1 A G 1: 54,528,592 S365P probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pus7l A G 15: 94,531,617 I440T possibly damaging Het
Raph1 C T 1: 60,502,869 S362N possibly damaging Het
Rftn2 A G 1: 55,202,152 Y330H possibly damaging Het
Rhot2 G A 17: 25,839,493 H580Y probably benign Het
Rnase2a A T 14: 51,255,845 M21K unknown Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Snx1 A T 9: 66,089,595 V459E possibly damaging Het
Suz12 A G 11: 80,032,113 T694A probably benign Het
Tg G A 15: 66,671,396 C53Y probably damaging Het
Tor1aip1 G T 1: 156,007,124 T326K probably damaging Het
Xlr5b T C X: 73,157,898 probably null Het
Other mutations in Vmn1r61
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01700:Vmn1r61 APN 7 5611203 missense possibly damaging 0.82
IGL02859:Vmn1r61 APN 7 5611289 missense probably benign 0.37
IGL03344:Vmn1r61 APN 7 5610494 missense possibly damaging 0.95
R0189:Vmn1r61 UTSW 7 5610700 missense probably benign 0.03
R0336:Vmn1r61 UTSW 7 5611067 missense probably benign
R0616:Vmn1r61 UTSW 7 5610999 missense possibly damaging 0.65
R1490:Vmn1r61 UTSW 7 5611243 missense probably benign 0.00
R1737:Vmn1r61 UTSW 7 5611061 missense probably benign 0.01
R1755:Vmn1r61 UTSW 7 5611303 nonsense probably null
R1795:Vmn1r61 UTSW 7 5611325 utr 5 prime probably benign
R3929:Vmn1r61 UTSW 7 5611177 missense probably benign 0.01
R4629:Vmn1r61 UTSW 7 5611250 missense probably benign 0.08
R4785:Vmn1r61 UTSW 7 5611125 nonsense probably null
R4785:Vmn1r61 UTSW 7 5611127 missense probably benign
R5108:Vmn1r61 UTSW 7 5610520 missense probably benign
R5305:Vmn1r61 UTSW 7 5610815 missense probably damaging 1.00
R5914:Vmn1r61 UTSW 7 5610530 missense probably damaging 1.00
R6150:Vmn1r61 UTSW 7 5610679 missense probably benign 0.00
R6232:Vmn1r61 UTSW 7 5610851 missense probably damaging 1.00
R6722:Vmn1r61 UTSW 7 5610688 missense possibly damaging 0.55
R7488:Vmn1r61 UTSW 7 5610768 missense possibly damaging 0.56
R7496:Vmn1r61 UTSW 7 5610431 missense probably benign 0.19
R8353:Vmn1r61 UTSW 7 5610887 missense probably benign 0.11
R8453:Vmn1r61 UTSW 7 5610887 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GTCCAGGCCATGATGCTTAG -3'
(R):5'- GCTGTAGCCAATGCAATCATGC -3'

Sequencing Primer
(F):5'- TCCAGGCCATGATGCTTAGGAATATG -3'
(R):5'- ATTGATTTTGTTCCCAGGAAGCC -3'
Posted On2015-07-21