Incidental Mutation 'R4487:BC017158'
ID331658
Institutional Source Beutler Lab
Gene Symbol BC017158
Ensembl Gene ENSMUSG00000030780
Gene NamecDNA sequence BC017158
SynonymsMGC:28903
MMRRC Submission 041743-MU
Accession Numbers

Genbank: NM_145590; MGI: 2384572

Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R4487 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location128271379-128298170 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128288358 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 24 (D24G)
Ref Sequence ENSEMBL: ENSMUSP00000117520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033044] [ENSMUST00000126263] [ENSMUST00000137677]
Predicted Effect probably damaging
Transcript: ENSMUST00000033044
AA Change: D167G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033044
Gene: ENSMUSG00000030780
AA Change: D167G

DomainStartEndE-ValueType
Pfam:DUF647 62 301 5.6e-97 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124216
Predicted Effect probably damaging
Transcript: ENSMUST00000126263
AA Change: D167G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114673
Gene: ENSMUSG00000030780
AA Change: D167G

DomainStartEndE-ValueType
Pfam:DUF647 61 304 3e-102 PFAM
low complexity region 334 347 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137677
AA Change: D24G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117520
Gene: ENSMUSG00000030780
AA Change: D24G

DomainStartEndE-ValueType
Pfam:DUF647 1 64 4.6e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139452
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154003
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155177
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175474
Meta Mutation Damage Score 0.9374 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative transmembrane protein containing a conserved DUF647 domain that may be involved in protein-protein interaction. The encoded protein is related to a plant protein that participates in ultraviolet B light-sensing during root morphogenesis. [provided by RefSeq, Feb 2013]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310030G06Rik A G 9: 50,740,631 L99P probably damaging Het
Abcd2 A G 15: 91,178,283 V484A probably damaging Het
Adgrv1 A G 13: 81,440,066 I4467T probably damaging Het
Ash1l T A 3: 88,985,315 D1500E possibly damaging Het
C1ql2 A T 1: 120,341,680 Y188F possibly damaging Het
Cnga2 T A X: 72,006,127 F133I possibly damaging Het
Crybg2 T C 4: 134,074,201 S891P probably benign Het
Hao2 T A 3: 98,882,025 I116F probably damaging Het
Htr1b A T 9: 81,631,539 D338E probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif9 A G 9: 110,494,484 E225G probably null Het
Krt76 T C 15: 101,890,482 K256R possibly damaging Het
Mapk4 T C 18: 73,930,975 D392G probably damaging Het
Mthfr A G 4: 148,051,427 K278R probably benign Het
Mup4 T A 4: 59,960,547 E18V probably damaging Het
Nepro A G 16: 44,735,726 K416E probably damaging Het
Ngf G A 3: 102,520,699 D255N probably damaging Het
Nmu A G 5: 76,344,062 probably null Het
Nt5m A G 11: 59,848,347 Y73C probably damaging Het
Oaz3 A T 3: 94,435,130 probably null Het
Pgap1 A G 1: 54,528,592 S365P probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pus7l A G 15: 94,531,617 I440T possibly damaging Het
Raph1 C T 1: 60,502,869 S362N possibly damaging Het
Rftn2 A G 1: 55,202,152 Y330H possibly damaging Het
Rhot2 G A 17: 25,839,493 H580Y probably benign Het
Rnase2a A T 14: 51,255,845 M21K unknown Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Snx1 A T 9: 66,089,595 V459E possibly damaging Het
Suz12 A G 11: 80,032,113 T694A probably benign Het
Tg G A 15: 66,671,396 C53Y probably damaging Het
Tor1aip1 G T 1: 156,007,124 T326K probably damaging Het
Vmn1r61 C A 7: 5,610,925 C130F possibly damaging Het
Xlr5b T C X: 73,157,898 probably null Het
Other mutations in BC017158
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02451:BC017158 APN 7 128276410 missense probably damaging 1.00
IGL02527:BC017158 APN 7 128276231 missense possibly damaging 0.92
IGL02572:BC017158 APN 7 128290580 splice site probably benign
3-1:BC017158 UTSW 7 128276129 missense possibly damaging 0.87
PIT4445001:BC017158 UTSW 7 128276534 missense probably benign 0.15
R0364:BC017158 UTSW 7 128290614 missense probably damaging 1.00
R0590:BC017158 UTSW 7 128297470 missense probably damaging 1.00
R0616:BC017158 UTSW 7 128272631 intron probably null
R2060:BC017158 UTSW 7 128288331 missense probably damaging 1.00
R3849:BC017158 UTSW 7 128285208 missense probably damaging 1.00
R4510:BC017158 UTSW 7 128276140 missense probably damaging 0.99
R4511:BC017158 UTSW 7 128276140 missense probably damaging 0.99
R4708:BC017158 UTSW 7 128274680 missense probably benign 0.00
R4793:BC017158 UTSW 7 128288202 intron probably benign
R4983:BC017158 UTSW 7 128276473 unclassified probably benign
R5502:BC017158 UTSW 7 128285136 missense probably damaging 1.00
R6181:BC017158 UTSW 7 128297460 critical splice donor site probably null
R6312:BC017158 UTSW 7 128273543 missense probably benign 0.02
R7898:BC017158 UTSW 7 128298005 missense probably benign 0.08
R7981:BC017158 UTSW 7 128298005 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TTCGAACTTCCTTCAGTACAGGG -3'
(R):5'- GTGACCTGACAACTCCTTACAGC -3'

Sequencing Primer
(F):5'- TTCCTTCAGTACAGGGACCGG -3'
(R):5'- CAGCAGTTTTCCTGTGTTCTAAATTG -3'
Posted On2015-07-21