Incidental Mutation 'R4487:Snx1'
ID331660
Institutional Source Beutler Lab
Gene Symbol Snx1
Ensembl Gene ENSMUSG00000032382
Gene Namesorting nexin 1
Synonyms
MMRRC Submission 041743-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4487 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location66088133-66126587 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 66089595 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 459 (V459E)
Ref Sequence ENSEMBL: ENSMUSP00000034946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034946]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034946
AA Change: V459E

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034946
Gene: ENSMUSG00000032382
AA Change: V459E

DomainStartEndE-ValueType
Pfam:Sorting_nexin 10 137 2.6e-29 PFAM
PX 140 267 7.59e-40 SMART
Pfam:Vps5 283 516 3.2e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132841
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143148
Meta Mutation Damage Score 0.8453 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This endosomal protein regulates the cell-surface expression of epidermal growth factor receptor. This protein also has a role in sorting protease-activated receptor-1 from early endosomes to lysosomes. This protein may form oligomeric complexes with family members. This gene results in three transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable and fertile and do not exhibit any apparent abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310030G06Rik A G 9: 50,740,631 L99P probably damaging Het
Abcd2 A G 15: 91,178,283 V484A probably damaging Het
Adgrv1 A G 13: 81,440,066 I4467T probably damaging Het
Ash1l T A 3: 88,985,315 D1500E possibly damaging Het
BC017158 T C 7: 128,288,358 D24G probably damaging Het
C1ql2 A T 1: 120,341,680 Y188F possibly damaging Het
Cnga2 T A X: 72,006,127 F133I possibly damaging Het
Crybg2 T C 4: 134,074,201 S891P probably benign Het
Hao2 T A 3: 98,882,025 I116F probably damaging Het
Htr1b A T 9: 81,631,539 D338E probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif9 A G 9: 110,494,484 E225G probably null Het
Krt76 T C 15: 101,890,482 K256R possibly damaging Het
Mapk4 T C 18: 73,930,975 D392G probably damaging Het
Mthfr A G 4: 148,051,427 K278R probably benign Het
Mup4 T A 4: 59,960,547 E18V probably damaging Het
Nepro A G 16: 44,735,726 K416E probably damaging Het
Ngf G A 3: 102,520,699 D255N probably damaging Het
Nmu A G 5: 76,344,062 probably null Het
Nt5m A G 11: 59,848,347 Y73C probably damaging Het
Oaz3 A T 3: 94,435,130 probably null Het
Pgap1 A G 1: 54,528,592 S365P probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pus7l A G 15: 94,531,617 I440T possibly damaging Het
Raph1 C T 1: 60,502,869 S362N possibly damaging Het
Rftn2 A G 1: 55,202,152 Y330H possibly damaging Het
Rhot2 G A 17: 25,839,493 H580Y probably benign Het
Rnase2a A T 14: 51,255,845 M21K unknown Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Suz12 A G 11: 80,032,113 T694A probably benign Het
Tg G A 15: 66,671,396 C53Y probably damaging Het
Tor1aip1 G T 1: 156,007,124 T326K probably damaging Het
Vmn1r61 C A 7: 5,610,925 C130F possibly damaging Het
Xlr5b T C X: 73,157,898 probably null Het
Other mutations in Snx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Snx1 APN 9 66089585 nonsense probably null
IGL01015:Snx1 APN 9 66094431 missense possibly damaging 0.72
IGL02070:Snx1 APN 9 66098449 missense probably damaging 0.97
IGL02225:Snx1 APN 9 66109621 missense probably benign 0.03
IGL02984:Snx1 APN 9 66089108 splice site probably benign
IGL03069:Snx1 APN 9 66094624 missense probably benign
IGL03188:Snx1 APN 9 66094452 missense probably damaging 1.00
FR4589:Snx1 UTSW 9 66104926 small insertion probably benign
FR4976:Snx1 UTSW 9 66104929 small insertion probably benign
FR4976:Snx1 UTSW 9 66104930 small insertion probably benign
R0116:Snx1 UTSW 9 66088539 nonsense probably null
R0243:Snx1 UTSW 9 66101326 splice site probably benign
R0755:Snx1 UTSW 9 66098456 missense probably damaging 1.00
R0981:Snx1 UTSW 9 66109559 missense probably benign
R1495:Snx1 UTSW 9 66096597 missense probably benign 0.23
R1528:Snx1 UTSW 9 66109543 missense probably damaging 1.00
R1725:Snx1 UTSW 9 66098329 critical splice donor site probably null
R3752:Snx1 UTSW 9 66105651 splice site probably null
R4778:Snx1 UTSW 9 66101416 intron probably benign
R4975:Snx1 UTSW 9 66104905 nonsense probably null
R5043:Snx1 UTSW 9 66097436 missense probably benign 0.04
R6346:Snx1 UTSW 9 66094648 missense possibly damaging 0.62
RF045:Snx1 UTSW 9 66104922 small insertion probably benign
T0722:Snx1 UTSW 9 66104927 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AAGCTTTCTCTGCGGGCAAG -3'
(R):5'- CTCCTGTAGAATTGCACCATGAC -3'

Sequencing Primer
(F):5'- AGGACACATAGCAGCTCCTGG -3'
(R):5'- TGACATTAAATGACACTGCGC -3'
Posted On2015-07-21