Incidental Mutation 'R4487:Kif9'
ID 331662
Institutional Source Beutler Lab
Gene Symbol Kif9
Ensembl Gene ENSMUSG00000032489
Gene Name kinesin family member 9
Synonyms
MMRRC Submission 041743-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R4487 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 110306062-110354242 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 110323552 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 225 (E225G)
Ref Sequence ENSEMBL: ENSMUSP00000142689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061155] [ENSMUST00000084952] [ENSMUST00000197248] [ENSMUST00000198043] [ENSMUST00000198858]
AlphaFold Q9WV04
Predicted Effect probably null
Transcript: ENSMUST00000061155
AA Change: E225G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000057896
Gene: ENSMUSG00000032489
AA Change: E225G

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 7e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000084952
AA Change: E225G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000082016
Gene: ENSMUSG00000032489
AA Change: E225G

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 7e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000197248
AA Change: E225G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142734
Gene: ENSMUSG00000032489
AA Change: E225G

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 6e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000198043
AA Change: E225G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142689
Gene: ENSMUSG00000032489
AA Change: E225G

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 476 5e-14 BLAST
low complexity region 489 501 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198858
SMART Domains Protein: ENSMUSP00000142888
Gene: ENSMUSG00000032489

DomainStartEndE-ValueType
KISc 9 144 6.7e-7 SMART
Meta Mutation Damage Score 0.3869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310030G06Rik A G 9: 50,651,931 (GRCm39) L99P probably damaging Het
Abcd2 A G 15: 91,062,486 (GRCm39) V484A probably damaging Het
Adgrv1 A G 13: 81,588,185 (GRCm39) I4467T probably damaging Het
Ash1l T A 3: 88,892,622 (GRCm39) D1500E possibly damaging Het
C1ql2 A T 1: 120,269,409 (GRCm39) Y188F possibly damaging Het
Cnga2 T A X: 71,049,733 (GRCm39) F133I possibly damaging Het
Crybg2 T C 4: 133,801,512 (GRCm39) S891P probably benign Het
Hao2 T A 3: 98,789,341 (GRCm39) I116F probably damaging Het
Htr1b A T 9: 81,513,592 (GRCm39) D338E probably benign Het
Kalrn C T 16: 33,810,180 (GRCm39) D2525N possibly damaging Het
Krt76 T C 15: 101,798,917 (GRCm39) K256R possibly damaging Het
Mapk4 T C 18: 74,064,046 (GRCm39) D392G probably damaging Het
Mthfr A G 4: 148,135,884 (GRCm39) K278R probably benign Het
Mup4 T A 4: 59,960,547 (GRCm39) E18V probably damaging Het
Nepro A G 16: 44,556,089 (GRCm39) K416E probably damaging Het
Ngf G A 3: 102,428,015 (GRCm39) D255N probably damaging Het
Nmu A G 5: 76,491,909 (GRCm39) probably null Het
Nt5m A G 11: 59,739,173 (GRCm39) Y73C probably damaging Het
Oaz3 A T 3: 94,342,437 (GRCm39) probably null Het
Pgap1 A G 1: 54,567,751 (GRCm39) S365P probably benign Het
Plxna2 C T 1: 194,431,625 (GRCm39) S538F probably damaging Het
Pus7l A G 15: 94,429,498 (GRCm39) I440T possibly damaging Het
Raph1 C T 1: 60,542,028 (GRCm39) S362N possibly damaging Het
Rftn2 A G 1: 55,241,311 (GRCm39) Y330H possibly damaging Het
Rhot2 G A 17: 26,058,467 (GRCm39) H580Y probably benign Het
Rnase2a A T 14: 51,493,302 (GRCm39) M21K unknown Het
Rusf1 T C 7: 127,887,530 (GRCm39) D24G probably damaging Het
Smchd1 T C 17: 71,714,230 (GRCm39) T878A probably benign Het
Snx1 A T 9: 65,996,877 (GRCm39) V459E possibly damaging Het
Suz12 A G 11: 79,922,939 (GRCm39) T694A probably benign Het
Tg G A 15: 66,543,245 (GRCm39) C53Y probably damaging Het
Tor1aip1 G T 1: 155,882,870 (GRCm39) T326K probably damaging Het
Vmn1r61 C A 7: 5,613,924 (GRCm39) C130F possibly damaging Het
Xlr5b T C X: 72,201,504 (GRCm39) probably null Het
Other mutations in Kif9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01630:Kif9 APN 9 110,314,138 (GRCm39) missense probably benign 0.03
IGL02273:Kif9 APN 9 110,339,538 (GRCm39) missense probably damaging 0.99
IGL02818:Kif9 APN 9 110,314,217 (GRCm39) missense probably damaging 1.00
R0034:Kif9 UTSW 9 110,348,679 (GRCm39) missense probably benign 0.23
R0034:Kif9 UTSW 9 110,348,679 (GRCm39) missense probably benign 0.23
R0047:Kif9 UTSW 9 110,314,106 (GRCm39) missense probably benign 0.05
R0047:Kif9 UTSW 9 110,314,106 (GRCm39) missense probably benign 0.05
R0137:Kif9 UTSW 9 110,314,106 (GRCm39) missense probably damaging 1.00
R0594:Kif9 UTSW 9 110,340,408 (GRCm39) missense probably benign 0.22
R1503:Kif9 UTSW 9 110,339,506 (GRCm39) missense possibly damaging 0.89
R1657:Kif9 UTSW 9 110,319,034 (GRCm39) missense possibly damaging 0.82
R1826:Kif9 UTSW 9 110,346,701 (GRCm39) missense probably benign 0.34
R1856:Kif9 UTSW 9 110,346,787 (GRCm39) missense probably null 1.00
R2076:Kif9 UTSW 9 110,314,100 (GRCm39) splice site probably null
R3407:Kif9 UTSW 9 110,348,208 (GRCm39) missense probably damaging 1.00
R4247:Kif9 UTSW 9 110,325,027 (GRCm39) critical splice donor site probably null
R4515:Kif9 UTSW 9 110,318,935 (GRCm39) missense probably benign 0.38
R4880:Kif9 UTSW 9 110,330,703 (GRCm39) missense probably damaging 0.98
R5024:Kif9 UTSW 9 110,312,161 (GRCm39) missense possibly damaging 0.81
R5093:Kif9 UTSW 9 110,318,965 (GRCm39) missense probably damaging 1.00
R5181:Kif9 UTSW 9 110,350,336 (GRCm39) missense probably damaging 1.00
R5362:Kif9 UTSW 9 110,319,012 (GRCm39) missense probably damaging 0.99
R5379:Kif9 UTSW 9 110,350,371 (GRCm39) missense probably benign 0.00
R5628:Kif9 UTSW 9 110,343,621 (GRCm39) nonsense probably null
R5653:Kif9 UTSW 9 110,353,999 (GRCm39) missense probably damaging 1.00
R5698:Kif9 UTSW 9 110,339,532 (GRCm39) missense probably benign
R5758:Kif9 UTSW 9 110,318,947 (GRCm39) missense probably damaging 1.00
R5986:Kif9 UTSW 9 110,319,094 (GRCm39) missense probably benign 0.05
R6103:Kif9 UTSW 9 110,318,917 (GRCm39) missense possibly damaging 0.82
R6247:Kif9 UTSW 9 110,317,612 (GRCm39) missense possibly damaging 0.78
R6255:Kif9 UTSW 9 110,346,902 (GRCm39) splice site probably null
R6991:Kif9 UTSW 9 110,323,690 (GRCm39) missense probably damaging 1.00
R7113:Kif9 UTSW 9 110,335,732 (GRCm39) missense probably damaging 1.00
R7459:Kif9 UTSW 9 110,348,109 (GRCm39) missense probably damaging 1.00
R7593:Kif9 UTSW 9 110,350,421 (GRCm39) missense possibly damaging 0.54
R7892:Kif9 UTSW 9 110,343,682 (GRCm39) missense not run
R8050:Kif9 UTSW 9 110,348,208 (GRCm39) missense probably damaging 1.00
R8370:Kif9 UTSW 9 110,317,681 (GRCm39) missense probably damaging 1.00
R8549:Kif9 UTSW 9 110,343,487 (GRCm39) splice site probably null
R8751:Kif9 UTSW 9 110,330,724 (GRCm39) missense probably benign 0.03
R8830:Kif9 UTSW 9 110,353,998 (GRCm39) missense probably damaging 1.00
R9489:Kif9 UTSW 9 110,346,710 (GRCm39) missense probably benign 0.01
R9519:Kif9 UTSW 9 110,350,344 (GRCm39) missense probably damaging 0.98
R9605:Kif9 UTSW 9 110,346,710 (GRCm39) missense probably benign 0.01
R9776:Kif9 UTSW 9 110,350,398 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGGTGGTGAAAGTACAGGACC -3'
(R):5'- CTGCCAGATCTACCAGGTTG -3'

Sequencing Primer
(F):5'- GACATTTCCTAGAAGGTCCAGCTG -3'
(R):5'- GCCAGATCTACCAGGTTGATTTTAG -3'
Posted On 2015-07-21