Incidental Mutation 'R4487:Nt5m'
ID331663
Institutional Source Beutler Lab
Gene Symbol Nt5m
Ensembl Gene ENSMUSG00000032615
Gene Name5',3'-nucleotidase, mitochondrial
Synonyms2010013E09Rik, dNT-2
MMRRC Submission 041743-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R4487 (G1)
Quality Score202
Status Validated
Chromosome11
Chromosomal Location59839447-59880968 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59848347 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 73 (Y73C)
Ref Sequence ENSEMBL: ENSMUSP00000099756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102695]
Predicted Effect probably damaging
Transcript: ENSMUST00000102695
AA Change: Y73C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099756
Gene: ENSMUSG00000032615
AA Change: Y73C

DomainStartEndE-ValueType
Pfam:NT5C 26 219 2.9e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137695
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154699
Meta Mutation Damage Score 0.7791 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 5' nucleotidase that localizes to the mitochondrial matrix. This enzyme dephosphorylates the 5'- and 2'(3')-phosphates of uracil and thymine deoxyribonucleotides. The gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310030G06Rik A G 9: 50,740,631 L99P probably damaging Het
Abcd2 A G 15: 91,178,283 V484A probably damaging Het
Adgrv1 A G 13: 81,440,066 I4467T probably damaging Het
Ash1l T A 3: 88,985,315 D1500E possibly damaging Het
BC017158 T C 7: 128,288,358 D24G probably damaging Het
C1ql2 A T 1: 120,341,680 Y188F possibly damaging Het
Cnga2 T A X: 72,006,127 F133I possibly damaging Het
Crybg2 T C 4: 134,074,201 S891P probably benign Het
Hao2 T A 3: 98,882,025 I116F probably damaging Het
Htr1b A T 9: 81,631,539 D338E probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif9 A G 9: 110,494,484 E225G probably null Het
Krt76 T C 15: 101,890,482 K256R possibly damaging Het
Mapk4 T C 18: 73,930,975 D392G probably damaging Het
Mthfr A G 4: 148,051,427 K278R probably benign Het
Mup4 T A 4: 59,960,547 E18V probably damaging Het
Nepro A G 16: 44,735,726 K416E probably damaging Het
Ngf G A 3: 102,520,699 D255N probably damaging Het
Nmu A G 5: 76,344,062 probably null Het
Oaz3 A T 3: 94,435,130 probably null Het
Pgap1 A G 1: 54,528,592 S365P probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pus7l A G 15: 94,531,617 I440T possibly damaging Het
Raph1 C T 1: 60,502,869 S362N possibly damaging Het
Rftn2 A G 1: 55,202,152 Y330H possibly damaging Het
Rhot2 G A 17: 25,839,493 H580Y probably benign Het
Rnase2a A T 14: 51,255,845 M21K unknown Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Snx1 A T 9: 66,089,595 V459E possibly damaging Het
Suz12 A G 11: 80,032,113 T694A probably benign Het
Tg G A 15: 66,671,396 C53Y probably damaging Het
Tor1aip1 G T 1: 156,007,124 T326K probably damaging Het
Vmn1r61 C A 7: 5,610,925 C130F possibly damaging Het
Xlr5b T C X: 73,157,898 probably null Het
Other mutations in Nt5m
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4520001:Nt5m UTSW 11 59874589 missense probably benign 0.31
R0442:Nt5m UTSW 11 59874619 missense possibly damaging 0.92
R2201:Nt5m UTSW 11 59875915 missense probably benign 0.14
R2237:Nt5m UTSW 11 59852870 missense probably benign 0.00
R4976:Nt5m UTSW 11 59874555 nonsense probably null
R5156:Nt5m UTSW 11 59874661 missense probably damaging 1.00
R5462:Nt5m UTSW 11 59874559 missense probably damaging 1.00
R5476:Nt5m UTSW 11 59875907 missense probably damaging 0.96
R5687:Nt5m UTSW 11 59852823 missense probably benign 0.31
Z1177:Nt5m UTSW 11 59874556 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TTTCACAGGCGGCTGTAACC -3'
(R):5'- AATGGTTGGTCCCTCTAGCC -3'

Sequencing Primer
(F):5'- CTGGGCGCATGTCCCTTTAAG -3'
(R):5'- AGCCCTGTAGCCCTAGTC -3'
Posted On2015-07-21