Incidental Mutation 'R4487:Nepro'
ID331671
Institutional Source Beutler Lab
Gene Symbol Nepro
Ensembl Gene ENSMUSG00000036208
Gene Namenucleolus and neural progenitor protein
SynonymsBC027231
MMRRC Submission 041743-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4487 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location44724301-44737284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44735726 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 416 (K416E)
Ref Sequence ENSEMBL: ENSMUSP00000038779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023348] [ENSMUST00000048788] [ENSMUST00000123673] [ENSMUST00000147804] [ENSMUST00000161436] [ENSMUST00000162512]
Predicted Effect probably benign
Transcript: ENSMUST00000023348
SMART Domains Protein: ENSMUSP00000023348
Gene: ENSMUSG00000022668

DomainStartEndE-ValueType
Pfam:SRPRB 42 164 4.1e-7 PFAM
Pfam:GTP_EFTU 42 214 3.4e-9 PFAM
Pfam:FeoB_N 45 208 5.9e-6 PFAM
Pfam:MMR_HSR1 46 161 5e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000048788
AA Change: K416E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038779
Gene: ENSMUSG00000036208
AA Change: K416E

DomainStartEndE-ValueType
Pfam:DUF4477 12 202 3.2e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130805
Predicted Effect probably benign
Transcript: ENSMUST00000132610
SMART Domains Protein: ENSMUSP00000116115
Gene: ENSMUSG00000036208

DomainStartEndE-ValueType
Pfam:DUF4477 1 118 7.5e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147804
Predicted Effect probably benign
Transcript: ENSMUST00000161436
SMART Domains Protein: ENSMUSP00000123974
Gene: ENSMUSG00000022668

DomainStartEndE-ValueType
Pfam:GTP_EFTU 65 230 5.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162512
SMART Domains Protein: ENSMUSP00000125352
Gene: ENSMUSG00000022668

DomainStartEndE-ValueType
Pfam:SRPRB 109 250 1.8e-7 PFAM
Pfam:MMR_HSR1 113 228 1.1e-18 PFAM
Meta Mutation Damage Score 0.1575 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality prior to implantation with a failure to form a blastocyst. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310030G06Rik A G 9: 50,740,631 L99P probably damaging Het
Abcd2 A G 15: 91,178,283 V484A probably damaging Het
Adgrv1 A G 13: 81,440,066 I4467T probably damaging Het
Ash1l T A 3: 88,985,315 D1500E possibly damaging Het
BC017158 T C 7: 128,288,358 D24G probably damaging Het
C1ql2 A T 1: 120,341,680 Y188F possibly damaging Het
Cnga2 T A X: 72,006,127 F133I possibly damaging Het
Crybg2 T C 4: 134,074,201 S891P probably benign Het
Hao2 T A 3: 98,882,025 I116F probably damaging Het
Htr1b A T 9: 81,631,539 D338E probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif9 A G 9: 110,494,484 E225G probably null Het
Krt76 T C 15: 101,890,482 K256R possibly damaging Het
Mapk4 T C 18: 73,930,975 D392G probably damaging Het
Mthfr A G 4: 148,051,427 K278R probably benign Het
Mup4 T A 4: 59,960,547 E18V probably damaging Het
Ngf G A 3: 102,520,699 D255N probably damaging Het
Nmu A G 5: 76,344,062 probably null Het
Nt5m A G 11: 59,848,347 Y73C probably damaging Het
Oaz3 A T 3: 94,435,130 probably null Het
Pgap1 A G 1: 54,528,592 S365P probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pus7l A G 15: 94,531,617 I440T possibly damaging Het
Raph1 C T 1: 60,502,869 S362N possibly damaging Het
Rftn2 A G 1: 55,202,152 Y330H possibly damaging Het
Rhot2 G A 17: 25,839,493 H580Y probably benign Het
Rnase2a A T 14: 51,255,845 M21K unknown Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Snx1 A T 9: 66,089,595 V459E possibly damaging Het
Suz12 A G 11: 80,032,113 T694A probably benign Het
Tg G A 15: 66,671,396 C53Y probably damaging Het
Tor1aip1 G T 1: 156,007,124 T326K probably damaging Het
Vmn1r61 C A 7: 5,610,925 C130F possibly damaging Het
Xlr5b T C X: 73,157,898 probably null Het
Other mutations in Nepro
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Nepro APN 16 44729305 nonsense probably null
IGL01688:Nepro APN 16 44736006 missense probably damaging 0.97
IGL03149:Nepro APN 16 44727099 missense probably damaging 1.00
IGL03046:Nepro UTSW 16 44732146 unclassified probably benign
R0839:Nepro UTSW 16 44736019 missense probably benign 0.27
R1619:Nepro UTSW 16 44727028 missense probably benign 0.01
R1777:Nepro UTSW 16 44735853 missense probably damaging 0.99
R4273:Nepro UTSW 16 44735829 missense possibly damaging 0.47
R4750:Nepro UTSW 16 44730182 missense probably damaging 1.00
R4841:Nepro UTSW 16 44734797 missense probably null 1.00
R4842:Nepro UTSW 16 44734797 missense probably null 1.00
R4869:Nepro UTSW 16 44730173 missense probably damaging 1.00
R4973:Nepro UTSW 16 44734793 missense probably benign 0.16
R4988:Nepro UTSW 16 44734542 missense possibly damaging 0.95
R6480:Nepro UTSW 16 44727075 missense probably damaging 1.00
R6830:Nepro UTSW 16 44731357 missense probably damaging 1.00
R7149:Nepro UTSW 16 44729715 critical splice donor site probably null
R8024:Nepro UTSW 16 44731415 missense probably benign 0.05
U24488:Nepro UTSW 16 44734586 missense probably benign 0.02
X0067:Nepro UTSW 16 44734703 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- ACCAAAGAGAGGTTGAAACTCTC -3'
(R):5'- TTAGCACTGCTGTCCCTAGTG -3'

Sequencing Primer
(F):5'- GAGAGGTTGAAACTCTCATTTCC -3'
(R):5'- AGTGTTCTTCAGAGTCCCTTCAGG -3'
Posted On2015-07-21