Incidental Mutation 'R4487:Mapk4'
ID331673
Institutional Source Beutler Lab
Gene Symbol Mapk4
Ensembl Gene ENSMUSG00000024558
Gene Namemitogen-activated protein kinase 4
SynonymsErk3-related, p63Mapk
MMRRC Submission 041743-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4487 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location73928486-74065359 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73930975 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 392 (D392G)
Ref Sequence ENSEMBL: ENSMUSP00000089462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091851] [ENSMUST00000159162] [ENSMUST00000162863]
Predicted Effect probably damaging
Transcript: ENSMUST00000091851
AA Change: D392G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089462
Gene: ENSMUSG00000024558
AA Change: D392G

DomainStartEndE-ValueType
S_TKc 20 312 3.81e-79 SMART
low complexity region 462 478 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159162
SMART Domains Protein: ENSMUSP00000123922
Gene: ENSMUSG00000024558

DomainStartEndE-ValueType
Pfam:Pkinase 20 232 2.3e-58 PFAM
Pfam:Pkinase_Tyr 22 232 5.5e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162863
SMART Domains Protein: ENSMUSP00000124408
Gene: ENSMUSG00000024558

DomainStartEndE-ValueType
Pfam:Pkinase 20 192 1.7e-41 PFAM
Pfam:Pkinase_Tyr 22 189 5.9e-25 PFAM
Meta Mutation Damage Score 0.0677 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitogen-activated protein kinase 4 is a member of the mitogen-activated protein kinase family. Tyrosine kinase growth factor receptors activate mitogen-activated protein kinases which then translocate into the nucleus and phosphorylate nuclear targets. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are viabel and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310030G06Rik A G 9: 50,740,631 L99P probably damaging Het
Abcd2 A G 15: 91,178,283 V484A probably damaging Het
Adgrv1 A G 13: 81,440,066 I4467T probably damaging Het
Ash1l T A 3: 88,985,315 D1500E possibly damaging Het
BC017158 T C 7: 128,288,358 D24G probably damaging Het
C1ql2 A T 1: 120,341,680 Y188F possibly damaging Het
Cnga2 T A X: 72,006,127 F133I possibly damaging Het
Crybg2 T C 4: 134,074,201 S891P probably benign Het
Hao2 T A 3: 98,882,025 I116F probably damaging Het
Htr1b A T 9: 81,631,539 D338E probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif9 A G 9: 110,494,484 E225G probably null Het
Krt76 T C 15: 101,890,482 K256R possibly damaging Het
Mthfr A G 4: 148,051,427 K278R probably benign Het
Mup4 T A 4: 59,960,547 E18V probably damaging Het
Nepro A G 16: 44,735,726 K416E probably damaging Het
Ngf G A 3: 102,520,699 D255N probably damaging Het
Nmu A G 5: 76,344,062 probably null Het
Nt5m A G 11: 59,848,347 Y73C probably damaging Het
Oaz3 A T 3: 94,435,130 probably null Het
Pgap1 A G 1: 54,528,592 S365P probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pus7l A G 15: 94,531,617 I440T possibly damaging Het
Raph1 C T 1: 60,502,869 S362N possibly damaging Het
Rftn2 A G 1: 55,202,152 Y330H possibly damaging Het
Rhot2 G A 17: 25,839,493 H580Y probably benign Het
Rnase2a A T 14: 51,255,845 M21K unknown Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Snx1 A T 9: 66,089,595 V459E possibly damaging Het
Suz12 A G 11: 80,032,113 T694A probably benign Het
Tg G A 15: 66,671,396 C53Y probably damaging Het
Tor1aip1 G T 1: 156,007,124 T326K probably damaging Het
Vmn1r61 C A 7: 5,610,925 C130F possibly damaging Het
Xlr5b T C X: 73,157,898 probably null Het
Other mutations in Mapk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02396:Mapk4 APN 18 73933997 intron probably null
IGL02621:Mapk4 APN 18 73970275 missense probably damaging 1.00
IGL03068:Mapk4 APN 18 73970344 missense probably damaging 1.00
R0041:Mapk4 UTSW 18 73935038 missense probably damaging 1.00
R0519:Mapk4 UTSW 18 73970321 missense probably damaging 1.00
R0636:Mapk4 UTSW 18 73930454 missense probably benign
R0918:Mapk4 UTSW 18 73970337 missense probably damaging 1.00
R1654:Mapk4 UTSW 18 73930939 missense probably damaging 1.00
R2913:Mapk4 UTSW 18 73935165 missense probably benign 0.34
R2914:Mapk4 UTSW 18 73935165 missense probably benign 0.34
R4089:Mapk4 UTSW 18 73930459 missense probably damaging 1.00
R4414:Mapk4 UTSW 18 73930538 missense possibly damaging 0.76
R4792:Mapk4 UTSW 18 73937250 missense probably damaging 0.98
R5445:Mapk4 UTSW 18 73931002 missense probably benign 0.00
R5597:Mapk4 UTSW 18 73937270 missense probably benign 0.12
R5654:Mapk4 UTSW 18 73970294 missense probably damaging 1.00
R6700:Mapk4 UTSW 18 73930811 missense probably damaging 1.00
R6793:Mapk4 UTSW 18 73930468 missense probably damaging 1.00
R7200:Mapk4 UTSW 18 73930919 missense possibly damaging 0.92
R7335:Mapk4 UTSW 18 73937267 missense possibly damaging 0.75
R8010:Mapk4 UTSW 18 73930576 missense probably benign 0.04
Z1176:Mapk4 UTSW 18 73937184 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGGATGAGCTTGGGTTC -3'
(R):5'- TAGCAGACTTGTGAGTAAAGGC -3'

Sequencing Primer
(F):5'- ATGAGCTTGGGTTCCGAGTAG -3'
(R):5'- CCAGGGATTAGGCGATTTGGC -3'
Posted On2015-07-21