Incidental Mutation 'R4487:Cnga2'
ID331674
Institutional Source Beutler Lab
Gene Symbol Cnga2
Ensembl Gene ENSMUSG00000005864
Gene Namecyclic nucleotide gated channel alpha 2
SynonymsOCNC1, Cnca, Cncg4
MMRRC Submission 041743-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4487 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location71991849-72010218 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72006127 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 133 (F133I)
Ref Sequence ENSEMBL: ENSMUSP00000006020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006020]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006020
AA Change: F133I

PolyPhen 2 Score 0.576 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000006020
Gene: ENSMUSG00000005864
AA Change: F133I

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
low complexity region 62 79 N/A INTRINSIC
low complexity region 113 129 N/A INTRINSIC
Pfam:Ion_trans 142 385 2.8e-30 PFAM
cNMP 456 580 4.54e-23 SMART
PDB:3SWY|C 599 642 2e-9 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145642
Meta Mutation Damage Score 0.1095 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: This gene encodes a transmembrane protein that is a subunit of the nucleotide-gated olfactory ion channel. Knock out of this gene affects development of the olfactory epithelium and olfactory bulb. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality within 2 days of birth, growth retardation, and abnormal olfactory neuron response to forskolin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310030G06Rik A G 9: 50,740,631 L99P probably damaging Het
Abcd2 A G 15: 91,178,283 V484A probably damaging Het
Adgrv1 A G 13: 81,440,066 I4467T probably damaging Het
Ash1l T A 3: 88,985,315 D1500E possibly damaging Het
BC017158 T C 7: 128,288,358 D24G probably damaging Het
C1ql2 A T 1: 120,341,680 Y188F possibly damaging Het
Crybg2 T C 4: 134,074,201 S891P probably benign Het
Hao2 T A 3: 98,882,025 I116F probably damaging Het
Htr1b A T 9: 81,631,539 D338E probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif9 A G 9: 110,494,484 E225G probably null Het
Krt76 T C 15: 101,890,482 K256R possibly damaging Het
Mapk4 T C 18: 73,930,975 D392G probably damaging Het
Mthfr A G 4: 148,051,427 K278R probably benign Het
Mup4 T A 4: 59,960,547 E18V probably damaging Het
Nepro A G 16: 44,735,726 K416E probably damaging Het
Ngf G A 3: 102,520,699 D255N probably damaging Het
Nmu A G 5: 76,344,062 probably null Het
Nt5m A G 11: 59,848,347 Y73C probably damaging Het
Oaz3 A T 3: 94,435,130 probably null Het
Pgap1 A G 1: 54,528,592 S365P probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pus7l A G 15: 94,531,617 I440T possibly damaging Het
Raph1 C T 1: 60,502,869 S362N possibly damaging Het
Rftn2 A G 1: 55,202,152 Y330H possibly damaging Het
Rhot2 G A 17: 25,839,493 H580Y probably benign Het
Rnase2a A T 14: 51,255,845 M21K unknown Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Snx1 A T 9: 66,089,595 V459E possibly damaging Het
Suz12 A G 11: 80,032,113 T694A probably benign Het
Tg G A 15: 66,671,396 C53Y probably damaging Het
Tor1aip1 G T 1: 156,007,124 T326K probably damaging Het
Vmn1r61 C A 7: 5,610,925 C130F possibly damaging Het
Xlr5b T C X: 73,157,898 probably null Het
Other mutations in Cnga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02512:Cnga2 APN X 72008925 missense probably damaging 1.00
IGL02633:Cnga2 APN X 72005049 splice site probably benign
IGL03059:Cnga2 APN X 72008272 missense probably damaging 1.00
IGL03215:Cnga2 APN X 72009166 missense probably damaging 1.00
IGL03332:Cnga2 APN X 72006194 missense probably damaging 1.00
R2128:Cnga2 UTSW X 72007788 missense possibly damaging 0.95
R4486:Cnga2 UTSW X 72006127 missense possibly damaging 0.58
R4489:Cnga2 UTSW X 72006127 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TGATCAGAATGGTTCAGAGGC -3'
(R):5'- GGAAAAGCACTGGGTTATTGC -3'

Sequencing Primer
(F):5'- AGAATGGTTCAGAGGCCTGGTATTTG -3'
(R):5'- CATACTCCCTGTCTAGAGGTGAG -3'
Posted On2015-07-21