Incidental Mutation 'R4498:Mff'
ID331676
Institutional Source Beutler Lab
Gene Symbol Mff
Ensembl Gene ENSMUSG00000026150
Gene Namemitochondrial fission factor
Synonyms
MMRRC Submission 041751-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.291) question?
Stock #R4498 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location82724890-82752394 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 82741780 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073025] [ENSMUST00000078332] [ENSMUST00000160744] [ENSMUST00000160786] [ENSMUST00000160972] [ENSMUST00000161648] [ENSMUST00000162003]
Predicted Effect probably benign
Transcript: ENSMUST00000073025
SMART Domains Protein: ENSMUSP00000072784
Gene: ENSMUSG00000026150

DomainStartEndE-ValueType
Pfam:Miff 1 239 6.6e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078332
SMART Domains Protein: ENSMUSP00000077446
Gene: ENSMUSG00000026150

DomainStartEndE-ValueType
Pfam:Miff 1 291 2.2e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159279
SMART Domains Protein: ENSMUSP00000123713
Gene: ENSMUSG00000026150

DomainStartEndE-ValueType
Pfam:Miff 1 147 1.6e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160044
SMART Domains Protein: ENSMUSP00000125005
Gene: ENSMUSG00000026150

DomainStartEndE-ValueType
Pfam:Miff 1 130 7.5e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160632
Predicted Effect probably benign
Transcript: ENSMUST00000160744
SMART Domains Protein: ENSMUSP00000125629
Gene: ENSMUSG00000026150

DomainStartEndE-ValueType
Pfam:Miff 1 137 2.6e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160750
SMART Domains Protein: ENSMUSP00000125223
Gene: ENSMUSG00000026150

DomainStartEndE-ValueType
Pfam:Miff 1 155 6.2e-67 PFAM
Pfam:Miff 144 220 2.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160786
SMART Domains Protein: ENSMUSP00000125230
Gene: ENSMUSG00000026150

DomainStartEndE-ValueType
Pfam:Miff 1 238 6e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160972
SMART Domains Protein: ENSMUSP00000124200
Gene: ENSMUSG00000026150

DomainStartEndE-ValueType
Pfam:Miff 1 152 8.1e-60 PFAM
Pfam:Miff 146 218 1.8e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161648
SMART Domains Protein: ENSMUSP00000124164
Gene: ENSMUSG00000026150

DomainStartEndE-ValueType
Pfam:Miff 1 243 1.1e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162003
SMART Domains Protein: ENSMUSP00000124334
Gene: ENSMUSG00000026150

DomainStartEndE-ValueType
Pfam:Miff 1 316 8.1e-143 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188333
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 91% (53/58)
MGI Phenotype PHENOTYPE: Homozygous knockout reduces mitochondrial hyperfusion-induced apoptotic cell death of endothelial cells of cardiac microvessels after induced ischemia/reperfusion injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 G A 15: 81,895,285 A97T probably damaging Het
Acot9 T A X: 155,264,068 L18* probably null Het
Arhgap12 A T 18: 6,111,774 C69S probably damaging Het
C87499 A T 4: 88,628,892 probably null Het
Ccdc17 G T 4: 116,597,241 probably benign Het
Ctnnd2 A C 15: 30,619,874 D124A probably damaging Het
Cux1 T C 5: 136,312,993 N424S probably damaging Het
Dhrs7c T C 11: 67,815,880 F214S possibly damaging Het
Fat2 T C 11: 55,270,097 D3269G possibly damaging Het
Fhod3 T A 18: 25,110,239 probably null Het
Glul G T 1: 153,907,103 G187* probably null Het
Gnmt ATTAGGGGATGGTCTTAGGG ATTAGGG 17: 46,725,736 probably benign Het
H2-Q7 A T 17: 35,439,530 Y48F probably damaging Het
Hes3 T C 4: 152,287,085 T136A probably benign Het
Krt40 T C 11: 99,543,074 T29A possibly damaging Het
Lrrc37a C A 11: 103,501,798 D934Y probably benign Het
Mctp2 T A 7: 72,183,851 D581V probably damaging Het
Med27 T C 2: 29,471,342 S38P probably damaging Het
Mmadhc T C 2: 50,280,224 K292R probably benign Het
Mmp24 A G 2: 155,813,988 I449V possibly damaging Het
Mthfd1 G T 12: 76,314,990 L123F probably damaging Het
Mug2 T A 6: 122,082,752 L1363Q probably damaging Het
Myh4 T C 11: 67,251,752 I913T probably damaging Het
Myo16 T A 8: 10,435,869 N649K probably benign Het
Myo7b A G 18: 32,014,229 I87T probably benign Het
Ndst4 A G 3: 125,438,358 D192G probably damaging Het
Nup155 A G 15: 8,153,673 D1239G possibly damaging Het
Olfr1444 T C 19: 12,862,669 V298A probably damaging Het
Olfr866 G C 9: 20,027,733 N68K possibly damaging Het
Phf10 T A 17: 14,945,115 N493I probably benign Het
Prr12 T C 7: 45,045,914 E1376G unknown Het
Rasa3 T C 8: 13,614,587 H75R probably benign Het
Rin3 G A 12: 102,369,680 V537M probably damaging Het
Samd4 C T 14: 47,096,109 T272I probably damaging Het
Sept5 C T 16: 18,623,392 G257D probably damaging Het
Serpina6 T C 12: 103,654,067 K141R probably benign Het
Siglecf T A 7: 43,352,276 I170N possibly damaging Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Stk40 G A 4: 126,129,751 probably null Het
Syne1 A G 10: 5,031,768 S8700P probably benign Het
Tbc1d4 C T 14: 101,608,336 G42E probably damaging Het
Tfap2c C T 2: 172,557,182 Q425* probably null Het
Tmem255b T C 8: 13,455,998 S202P probably damaging Het
Traf6 T C 2: 101,684,546 S16P probably benign Het
Ttc12 A G 9: 49,472,405 I66T probably damaging Het
Ttc21a G A 9: 119,958,819 D818N possibly damaging Het
Zfp81 A T 17: 33,334,703 I379N possibly damaging Het
Zgrf1 C A 3: 127,586,100 S211* probably null Het
Other mutations in Mff
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Mff APN 1 82741975 missense probably damaging 1.00
IGL02934:Mff APN 1 82747094 missense probably damaging 1.00
IGL03381:Mff APN 1 82741940 missense probably damaging 1.00
R0652:Mff UTSW 1 82750564 missense possibly damaging 0.91
R0755:Mff UTSW 1 82750605 critical splice donor site probably null
R1215:Mff UTSW 1 82741888 missense probably benign 0.45
R2074:Mff UTSW 1 82751700 missense probably damaging 1.00
R2078:Mff UTSW 1 82741921 missense probably damaging 1.00
R2365:Mff UTSW 1 82735471 missense possibly damaging 0.74
R5099:Mff UTSW 1 82750471 intron probably benign
R5867:Mff UTSW 1 82750606 critical splice donor site probably null
R5984:Mff UTSW 1 82731127 missense probably benign 0.00
R6723:Mff UTSW 1 82751666 missense possibly damaging 0.91
R7135:Mff UTSW 1 82747091 nonsense probably null
R7373:Mff UTSW 1 82737117 splice site probably null
R7475:Mff UTSW 1 82745438 splice site probably null
R7792:Mff UTSW 1 82747081 critical splice acceptor site probably null
R8088:Mff UTSW 1 82751649 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACACTCATTGCTGGGTC -3'
(R):5'- GTTTTCATCCAGCACATCCAAGATC -3'

Sequencing Primer
(F):5'- CAAGTTTTCCCTCTGCTCGGATTG -3'
(R):5'- GCACATCCAAGATCTGCTGGTAAG -3'
Posted On2015-07-21