Incidental Mutation 'R4498:Spopl'
ID331678
Institutional Source Beutler Lab
Gene Symbol Spopl
Ensembl Gene ENSMUSG00000026771
Gene Namespeckle-type POZ protein-like
SynonymsE430033K04Rik, 4921517N04Rik
MMRRC Submission 041751-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4498 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location23506220-23572106 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 23517945 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 241 (V241M)
Ref Sequence ENSEMBL: ENSMUSP00000114974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028110] [ENSMUST00000132484] [ENSMUST00000132827]
Predicted Effect probably benign
Transcript: ENSMUST00000028110
SMART Domains Protein: ENSMUSP00000141519
Gene: ENSMUSG00000026771

DomainStartEndE-ValueType
MATH 2 108 5.9e-17 SMART
low complexity region 141 152 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132484
AA Change: V241M

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114974
Gene: ENSMUSG00000026771
AA Change: V241M

DomainStartEndE-ValueType
MATH 36 142 9.46e-15 SMART
BTB 200 297 5.99e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132827
SMART Domains Protein: ENSMUSP00000142047
Gene: ENSMUSG00000026771

DomainStartEndE-ValueType
MATH 36 142 5.9e-17 SMART
low complexity region 175 186 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195415
Meta Mutation Damage Score 0.2768 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 91% (53/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile with no gross morphological and skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 G A 15: 81,895,285 A97T probably damaging Het
Acot9 T A X: 155,264,068 L18* probably null Het
Arhgap12 A T 18: 6,111,774 C69S probably damaging Het
C87499 A T 4: 88,628,892 probably null Het
Ccdc17 G T 4: 116,597,241 probably benign Het
Ctnnd2 A C 15: 30,619,874 D124A probably damaging Het
Cux1 T C 5: 136,312,993 N424S probably damaging Het
Dhrs7c T C 11: 67,815,880 F214S possibly damaging Het
Fat2 T C 11: 55,270,097 D3269G possibly damaging Het
Fhod3 T A 18: 25,110,239 probably null Het
Glul G T 1: 153,907,103 G187* probably null Het
Gnmt ATTAGGGGATGGTCTTAGGG ATTAGGG 17: 46,725,736 probably benign Het
H2-Q7 A T 17: 35,439,530 Y48F probably damaging Het
Hes3 T C 4: 152,287,085 T136A probably benign Het
Krt40 T C 11: 99,543,074 T29A possibly damaging Het
Lrrc37a C A 11: 103,501,798 D934Y probably benign Het
Mctp2 T A 7: 72,183,851 D581V probably damaging Het
Med27 T C 2: 29,471,342 S38P probably damaging Het
Mff A G 1: 82,741,780 probably benign Het
Mmadhc T C 2: 50,280,224 K292R probably benign Het
Mmp24 A G 2: 155,813,988 I449V possibly damaging Het
Mthfd1 G T 12: 76,314,990 L123F probably damaging Het
Mug2 T A 6: 122,082,752 L1363Q probably damaging Het
Myh4 T C 11: 67,251,752 I913T probably damaging Het
Myo16 T A 8: 10,435,869 N649K probably benign Het
Myo7b A G 18: 32,014,229 I87T probably benign Het
Ndst4 A G 3: 125,438,358 D192G probably damaging Het
Nup155 A G 15: 8,153,673 D1239G possibly damaging Het
Olfr1444 T C 19: 12,862,669 V298A probably damaging Het
Olfr866 G C 9: 20,027,733 N68K possibly damaging Het
Phf10 T A 17: 14,945,115 N493I probably benign Het
Prr12 T C 7: 45,045,914 E1376G unknown Het
Rasa3 T C 8: 13,614,587 H75R probably benign Het
Rin3 G A 12: 102,369,680 V537M probably damaging Het
Samd4 C T 14: 47,096,109 T272I probably damaging Het
Sept5 C T 16: 18,623,392 G257D probably damaging Het
Serpina6 T C 12: 103,654,067 K141R probably benign Het
Siglecf T A 7: 43,352,276 I170N possibly damaging Het
Stk40 G A 4: 126,129,751 probably null Het
Syne1 A G 10: 5,031,768 S8700P probably benign Het
Tbc1d4 C T 14: 101,608,336 G42E probably damaging Het
Tfap2c C T 2: 172,557,182 Q425* probably null Het
Tmem255b T C 8: 13,455,998 S202P probably damaging Het
Traf6 T C 2: 101,684,546 S16P probably benign Het
Ttc12 A G 9: 49,472,405 I66T probably damaging Het
Ttc21a G A 9: 119,958,819 D818N possibly damaging Het
Zfp81 A T 17: 33,334,703 I379N possibly damaging Het
Zgrf1 C A 3: 127,586,100 S211* probably null Het
Other mutations in Spopl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Spopl APN 2 23537631 missense possibly damaging 0.88
P4748:Spopl UTSW 2 23511443 missense probably benign 0.01
PIT4453001:Spopl UTSW 2 23545449 missense probably damaging 0.99
R0738:Spopl UTSW 2 23537521 missense probably benign 0.04
R2358:Spopl UTSW 2 23537380 missense probably damaging 1.00
R3711:Spopl UTSW 2 23537380 missense probably damaging 1.00
R3712:Spopl UTSW 2 23537380 missense probably damaging 1.00
R4097:Spopl UTSW 2 23511401 missense probably benign 0.01
R4400:Spopl UTSW 2 23517945 missense probably damaging 0.97
R4421:Spopl UTSW 2 23517945 missense probably damaging 0.97
R4497:Spopl UTSW 2 23517945 missense probably damaging 0.97
R4570:Spopl UTSW 2 23537485 nonsense probably null
R4702:Spopl UTSW 2 23515297 splice site probably null
R6919:Spopl UTSW 2 23517861 missense probably benign 0.06
R7387:Spopl UTSW 2 23537509 missense probably benign
X0067:Spopl UTSW 2 23544867 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTTCCAATAAATAGCAAGTTGGAGG -3'
(R):5'- AGGTTCTCACTTAGTAGCTTCACTATC -3'

Sequencing Primer
(F):5'- AGCAAGTTGGAGGATTTTTGTTTTTG -3'
(R):5'- AGTAGCTTCACTATCTCTGTATGTAC -3'
Posted On2015-07-21