Incidental Mutation 'R4498:Gnmt'
ID331722
Institutional Source Beutler Lab
Gene Symbol Gnmt
Ensembl Gene ENSMUSG00000002769
Gene Nameglycine N-methyltransferase
Synonymsglycine N methyl transferase
MMRRC Submission 041751-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.395) question?
Stock #R4498 (G1)
Quality Score217
Status Validated
Chromosome17
Chromosomal Location46725664-46729168 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) ATTAGGGGATGGTCTTAGGG to ATTAGGG at 46725736 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000002846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002840] [ENSMUST00000002846]
PDB Structure
Crystal Structure of Mouse Glycine N-Methyltransferase (Tetragonal Form) [X-RAY DIFFRACTION]
Crystal Structure of Mouse Glycine N-Methyltransferase (Monoclinic Form) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000002840
SMART Domains Protein: ENSMUSP00000002840
Gene: ENSMUSG00000002763

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
low complexity region 72 86 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 112 128 N/A INTRINSIC
low complexity region 173 200 N/A INTRINSIC
AAA 463 598 6.1e-7 SMART
AAA 737 875 6e-24 SMART
Blast:AAA 928 973 1e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000002846
SMART Domains Protein: ENSMUSP00000002846
Gene: ENSMUSG00000002769

DomainStartEndE-ValueType
Pfam:Methyltransf_23 27 217 9e-11 PFAM
Pfam:Methyltransf_31 56 224 1.3e-15 PFAM
Pfam:Methyltransf_18 57 176 1.5e-15 PFAM
Pfam:Methyltransf_25 61 169 1.4e-10 PFAM
Pfam:Methyltransf_12 62 171 4e-12 PFAM
Pfam:Methyltransf_11 62 173 2.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148872
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 91% (53/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzyme that catalyzes the conversion of S-adenosyl-L-methionine (along with glycine) to S-adenosyl-L-homocysteine and sarcosine. This protein is found in the cytoplasm and acts as a homotetramer. Defects in this gene are a cause of GNMT deficiency (hypermethioninemia). Alternative splicing results in multiple transcript variants. Naturally occurring readthrough transcription occurs between the upstream CNPY3 (canopy FGF signaling regulator 3) gene and this gene and is represented with GeneID:107080644. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null mutation display elevated levels of methionine and S-adenosylmethionine in the liver. Mice homozygous for another null allele exhibit hepatitis, increased hepatic glycogen storage, and hepatocellular carcinoma. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 G A 15: 81,895,285 A97T probably damaging Het
Acot9 T A X: 155,264,068 L18* probably null Het
Arhgap12 A T 18: 6,111,774 C69S probably damaging Het
C87499 A T 4: 88,628,892 probably null Het
Ccdc17 G T 4: 116,597,241 probably benign Het
Ctnnd2 A C 15: 30,619,874 D124A probably damaging Het
Cux1 T C 5: 136,312,993 N424S probably damaging Het
Dhrs7c T C 11: 67,815,880 F214S possibly damaging Het
Fat2 T C 11: 55,270,097 D3269G possibly damaging Het
Fhod3 T A 18: 25,110,239 probably null Het
Glul G T 1: 153,907,103 G187* probably null Het
H2-Q7 A T 17: 35,439,530 Y48F probably damaging Het
Hes3 T C 4: 152,287,085 T136A probably benign Het
Krt40 T C 11: 99,543,074 T29A possibly damaging Het
Lrrc37a C A 11: 103,501,798 D934Y probably benign Het
Mctp2 T A 7: 72,183,851 D581V probably damaging Het
Med27 T C 2: 29,471,342 S38P probably damaging Het
Mff A G 1: 82,741,780 probably benign Het
Mmadhc T C 2: 50,280,224 K292R probably benign Het
Mmp24 A G 2: 155,813,988 I449V possibly damaging Het
Mthfd1 G T 12: 76,314,990 L123F probably damaging Het
Mug2 T A 6: 122,082,752 L1363Q probably damaging Het
Myh4 T C 11: 67,251,752 I913T probably damaging Het
Myo16 T A 8: 10,435,869 N649K probably benign Het
Myo7b A G 18: 32,014,229 I87T probably benign Het
Ndst4 A G 3: 125,438,358 D192G probably damaging Het
Nup155 A G 15: 8,153,673 D1239G possibly damaging Het
Olfr1444 T C 19: 12,862,669 V298A probably damaging Het
Olfr866 G C 9: 20,027,733 N68K possibly damaging Het
Phf10 T A 17: 14,945,115 N493I probably benign Het
Prr12 T C 7: 45,045,914 E1376G unknown Het
Rasa3 T C 8: 13,614,587 H75R probably benign Het
Rin3 G A 12: 102,369,680 V537M probably damaging Het
Samd4 C T 14: 47,096,109 T272I probably damaging Het
Sept5 C T 16: 18,623,392 G257D probably damaging Het
Serpina6 T C 12: 103,654,067 K141R probably benign Het
Siglecf T A 7: 43,352,276 I170N possibly damaging Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Stk40 G A 4: 126,129,751 probably null Het
Syne1 A G 10: 5,031,768 S8700P probably benign Het
Tbc1d4 C T 14: 101,608,336 G42E probably damaging Het
Tfap2c C T 2: 172,557,182 Q425* probably null Het
Tmem255b T C 8: 13,455,998 S202P probably damaging Het
Traf6 T C 2: 101,684,546 S16P probably benign Het
Ttc12 A G 9: 49,472,405 I66T probably damaging Het
Ttc21a G A 9: 119,958,819 D818N possibly damaging Het
Zfp81 A T 17: 33,334,703 I379N possibly damaging Het
Zgrf1 C A 3: 127,586,100 S211* probably null Het
Other mutations in Gnmt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01351:Gnmt APN 17 46726680 missense probably benign 0.28
health_nut UTSW 17 46726345 missense probably damaging 1.00
impulsive UTSW 17 46725966 missense probably damaging 1.00
rash UTSW 17 46725736 utr 3 prime probably benign
R0480:Gnmt UTSW 17 46725928 missense probably benign 0.06
R0938:Gnmt UTSW 17 46726345 missense probably damaging 1.00
R0939:Gnmt UTSW 17 46726345 missense probably damaging 1.00
R0940:Gnmt UTSW 17 46726345 missense probably damaging 1.00
R0941:Gnmt UTSW 17 46726345 missense probably damaging 1.00
R3619:Gnmt UTSW 17 46729037 missense possibly damaging 0.63
R4173:Gnmt UTSW 17 46726121 missense probably damaging 1.00
R4456:Gnmt UTSW 17 46728984 missense probably benign 0.07
R4659:Gnmt UTSW 17 46725966 missense probably damaging 1.00
R4669:Gnmt UTSW 17 46726299 nonsense probably null
R4827:Gnmt UTSW 17 46727319 missense possibly damaging 0.77
R5112:Gnmt UTSW 17 46726330 missense probably damaging 1.00
R5133:Gnmt UTSW 17 46725934 missense probably benign
R5797:Gnmt UTSW 17 46726379 missense probably damaging 1.00
R7423:Gnmt UTSW 17 46726140 missense probably damaging 1.00
R7825:Gnmt UTSW 17 46729093 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTCCTACTGGTCTTGTGAGAG -3'
(R):5'- TACCCACACTGTTTGGCGTC -3'

Sequencing Primer
(F):5'- CCTACTGGTCTTGTGAGAGGTTGC -3'
(R):5'- TCACGGAGTTGGTGCGAGC -3'
Posted On2015-07-21