Incidental Mutation 'R4499:Asnsd1'
ID331728
Institutional Source Beutler Lab
Gene Symbol Asnsd1
Ensembl Gene ENSMUSG00000026095
Gene Nameasparagine synthetase domain containing 1
Synonyms2210409M21Rik
MMRRC Submission 041752-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R4499 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location53344617-53352752 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53347970 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 166 (V166A)
Ref Sequence ENSEMBL: ENSMUSP00000139404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027264] [ENSMUST00000123519] [ENSMUST00000144660] [ENSMUST00000147021] [ENSMUST00000154402]
Predicted Effect probably benign
Transcript: ENSMUST00000027264
AA Change: V166A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027264
Gene: ENSMUSG00000026095
AA Change: V166A

DomainStartEndE-ValueType
Pfam:GATase_7 59 162 2.4e-8 PFAM
Pfam:Asn_synthase 305 388 6.9e-7 PFAM
Pfam:Asn_synthase 505 619 2.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123519
SMART Domains Protein: ENSMUSP00000139025
Gene: ENSMUSG00000026095

DomainStartEndE-ValueType
Pfam:Asn_synthase 2 120 4.5e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136468
Predicted Effect probably benign
Transcript: ENSMUST00000144660
AA Change: V166A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139404
Gene: ENSMUSG00000099913
AA Change: V166A

DomainStartEndE-ValueType
Pfam:GATase_7 59 162 1.4e-8 PFAM
Pfam:Asn_synthase 304 565 5.6e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147021
Predicted Effect probably benign
Transcript: ENSMUST00000154402
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 92% (47/51)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,316,527 W948R possibly damaging Het
Ache A C 5: 137,291,932 M508L probably damaging Het
Adgrb2 A T 4: 129,992,661 E198V probably damaging Het
Adgrl4 A G 3: 151,510,785 N535S possibly damaging Het
Agbl3 T C 6: 34,857,598 S906P probably benign Het
Akna T C 4: 63,395,041 T282A probably benign Het
Arfgef2 G A 2: 166,885,814 V1561M probably damaging Het
Arfgef3 T C 10: 18,608,343 D1388G possibly damaging Het
Bank1 T C 3: 136,284,243 I29V probably benign Het
Bpifb5 A T 2: 154,240,758 I484F possibly damaging Het
Camta2 T C 11: 70,674,686 E788G probably damaging Het
Ccdc18 T G 5: 108,228,960 S1422R possibly damaging Het
Cdc42bpg C T 19: 6,320,555 P1226L possibly damaging Het
Cep126 T C 9: 8,101,588 N315S possibly damaging Het
Dcaf4 T A 12: 83,539,360 L367Q probably damaging Het
Dcc A T 18: 71,547,317 V616D probably benign Het
Dennd4a G A 9: 64,910,123 D1680N possibly damaging Het
Dgkq C G 5: 108,649,661 E788D possibly damaging Het
Dpep2 T C 8: 105,985,482 E282G probably benign Het
Gm14124 T G 2: 150,269,442 V684G possibly damaging Het
Gm8221 T A 15: 77,626,045 noncoding transcript Het
Ice1 T C 13: 70,609,027 S280G possibly damaging Het
Lrrc2 A T 9: 110,962,645 Q155L probably benign Het
Mesd G A 7: 83,897,977 R216Q probably benign Het
Msh6 T A 17: 87,980,269 N112K probably damaging Het
Myo15b A G 11: 115,890,952 E307G probably benign Het
Nod1 T A 6: 54,943,996 N446Y probably damaging Het
Nrap G A 19: 56,351,481 T787I probably damaging Het
P2ry12 A G 3: 59,217,657 I199T probably damaging Het
Prr11 T G 11: 87,098,707 K279N possibly damaging Het
Psg25 C T 7: 18,524,891 E287K possibly damaging Het
Rusc1 T C 3: 89,092,308 S56G probably benign Het
Slc16a7 T C 10: 125,228,187 N427S probably damaging Het
Slc47a1 T A 11: 61,359,529 I341L probably benign Het
Slc9a8 T A 2: 167,424,193 L30Q probably benign Het
Ssh2 T A 11: 77,393,067 L49* probably null Het
Stard9 T A 2: 120,700,241 D2326E probably benign Het
Thbs1 T C 2: 118,119,950 I688T possibly damaging Het
Ttn T A 2: 76,916,478 E4742D probably benign Het
Vps37b T C 5: 124,007,626 I117V probably damaging Het
Xirp2 A T 2: 67,513,438 M2008L probably benign Het
Zfp53 A G 17: 21,509,235 E510G probably damaging Het
Zswim8 T A 14: 20,714,297 S578R probably benign Het
Other mutations in Asnsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Asnsd1 APN 1 53346628 missense probably damaging 1.00
IGL00595:Asnsd1 APN 1 53347488 missense probably damaging 1.00
IGL00705:Asnsd1 APN 1 53348451 missense probably damaging 1.00
IGL01089:Asnsd1 APN 1 53348277 missense probably damaging 1.00
IGL01747:Asnsd1 APN 1 53348095 nonsense probably null
IGL02274:Asnsd1 APN 1 53347575 missense probably benign
R2021:Asnsd1 UTSW 1 53347227 missense possibly damaging 0.53
R2022:Asnsd1 UTSW 1 53347227 missense possibly damaging 0.53
R2126:Asnsd1 UTSW 1 53347317 missense probably benign 0.00
R2174:Asnsd1 UTSW 1 53347601 missense probably benign 0.44
R4120:Asnsd1 UTSW 1 53347995 missense probably damaging 1.00
R4435:Asnsd1 UTSW 1 53348073 unclassified probably null
R4464:Asnsd1 UTSW 1 53352527 splice site probably null
R4622:Asnsd1 UTSW 1 53348219 missense probably benign 0.13
R5090:Asnsd1 UTSW 1 53352404 unclassified probably benign
R5832:Asnsd1 UTSW 1 53347475 missense probably damaging 1.00
R5891:Asnsd1 UTSW 1 53347977 missense probably benign 0.00
R6215:Asnsd1 UTSW 1 53348028 unclassified probably null
R6217:Asnsd1 UTSW 1 53348028 missense probably benign 0.02
R6353:Asnsd1 UTSW 1 53347779 missense probably benign
R6405:Asnsd1 UTSW 1 53347995 missense probably damaging 1.00
R6913:Asnsd1 UTSW 1 53348231 missense probably damaging 0.99
R7217:Asnsd1 UTSW 1 53348193 missense probably damaging 1.00
R7570:Asnsd1 UTSW 1 53348258 missense probably damaging 1.00
R7589:Asnsd1 UTSW 1 53347967 missense probably benign 0.00
R7716:Asnsd1 UTSW 1 53347743 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AATCCTGCTGGAGTCTGAGTC -3'
(R):5'- AGATAATGACACCCAGGTTATGTTC -3'

Sequencing Primer
(F):5'- CTGGAGTCTGAGTCAGGTCATTAC -3'
(R):5'- AGCCTTTCTGCCTGTAAGAATGAGTC -3'
Posted On2015-07-21