Incidental Mutation 'R4499:Arfgef2'
ID331736
Institutional Source Beutler Lab
Gene Symbol Arfgef2
Ensembl Gene ENSMUSG00000074582
Gene NameADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)
SynonymsE230011G24Rik, BIG2
MMRRC Submission 041752-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.365) question?
Stock #R4499 (G1)
Quality Score173
Status Validated
Chromosome2
Chromosomal Location166805588-166898052 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 166885814 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 1561 (V1561M)
Ref Sequence ENSEMBL: ENSMUSP00000096677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099078]
Predicted Effect probably damaging
Transcript: ENSMUST00000099078
AA Change: V1561M

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000096677
Gene: ENSMUSG00000074582
AA Change: V1561M

DomainStartEndE-ValueType
Pfam:DCB 7 200 1.6e-40 PFAM
Pfam:Sec7_N 377 536 3.7e-53 PFAM
Blast:Sec7 549 598 8e-18 BLAST
low complexity region 621 633 N/A INTRINSIC
Sec7 647 834 1.55e-97 SMART
Blast:Sec7 853 888 2e-11 BLAST
Blast:Sec7 902 941 4e-15 BLAST
low complexity region 1044 1055 N/A INTRINSIC
Pfam:DUF1981 1174 1257 6e-38 PFAM
low complexity region 1719 1729 N/A INTRINSIC
Meta Mutation Damage Score 0.1786 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 92% (47/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosylation factors (ARFs) play an important role in intracellular vesicular trafficking. The protein encoded by this gene is involved in the activation of ARFs by accelerating replacement of bound GDP with GTP and is involved in Golgi transport. It contains a Sec7 domain, which may be responsible for its guanine-nucleotide exchange activity and also brefeldin A inhibition. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit exencephaly, midline gut closure defects, periventricular and subependymal heterotopia, and impaired neuronal migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,316,527 W948R possibly damaging Het
Ache A C 5: 137,291,932 M508L probably damaging Het
Adgrb2 A T 4: 129,992,661 E198V probably damaging Het
Adgrl4 A G 3: 151,510,785 N535S possibly damaging Het
Agbl3 T C 6: 34,857,598 S906P probably benign Het
Akna T C 4: 63,395,041 T282A probably benign Het
Arfgef3 T C 10: 18,608,343 D1388G possibly damaging Het
Asnsd1 A G 1: 53,347,970 V166A probably benign Het
Bank1 T C 3: 136,284,243 I29V probably benign Het
Bpifb5 A T 2: 154,240,758 I484F possibly damaging Het
Camta2 T C 11: 70,674,686 E788G probably damaging Het
Ccdc18 T G 5: 108,228,960 S1422R possibly damaging Het
Cdc42bpg C T 19: 6,320,555 P1226L possibly damaging Het
Cep126 T C 9: 8,101,588 N315S possibly damaging Het
Dcaf4 T A 12: 83,539,360 L367Q probably damaging Het
Dcc A T 18: 71,547,317 V616D probably benign Het
Dennd4a G A 9: 64,910,123 D1680N possibly damaging Het
Dgkq C G 5: 108,649,661 E788D possibly damaging Het
Dpep2 T C 8: 105,985,482 E282G probably benign Het
Gm14124 T G 2: 150,269,442 V684G possibly damaging Het
Gm8221 T A 15: 77,626,045 noncoding transcript Het
Ice1 T C 13: 70,609,027 S280G possibly damaging Het
Lrrc2 A T 9: 110,962,645 Q155L probably benign Het
Mesd G A 7: 83,897,977 R216Q probably benign Het
Msh6 T A 17: 87,980,269 N112K probably damaging Het
Myo15b A G 11: 115,890,952 E307G probably benign Het
Nod1 T A 6: 54,943,996 N446Y probably damaging Het
Nrap G A 19: 56,351,481 T787I probably damaging Het
P2ry12 A G 3: 59,217,657 I199T probably damaging Het
Prr11 T G 11: 87,098,707 K279N possibly damaging Het
Psg25 C T 7: 18,524,891 E287K possibly damaging Het
Rusc1 T C 3: 89,092,308 S56G probably benign Het
Slc16a7 T C 10: 125,228,187 N427S probably damaging Het
Slc47a1 T A 11: 61,359,529 I341L probably benign Het
Slc9a8 T A 2: 167,424,193 L30Q probably benign Het
Ssh2 T A 11: 77,393,067 L49* probably null Het
Stard9 T A 2: 120,700,241 D2326E probably benign Het
Thbs1 T C 2: 118,119,950 I688T possibly damaging Het
Ttn T A 2: 76,916,478 E4742D probably benign Het
Vps37b T C 5: 124,007,626 I117V probably damaging Het
Xirp2 A T 2: 67,513,438 M2008L probably benign Het
Zfp53 A G 17: 21,509,235 E510G probably damaging Het
Zswim8 T A 14: 20,714,297 S578R probably benign Het
Other mutations in Arfgef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Arfgef2 APN 2 166885853 missense probably damaging 1.00
IGL01323:Arfgef2 APN 2 166871495 missense probably damaging 1.00
IGL01415:Arfgef2 APN 2 166867355 missense probably damaging 0.98
IGL01638:Arfgef2 APN 2 166873945 missense probably damaging 0.97
IGL02618:Arfgef2 APN 2 166853313 missense probably damaging 1.00
IGL02899:Arfgef2 APN 2 166869051 splice site probably benign
IGL03012:Arfgef2 APN 2 166868888 splice site probably benign
IGL03063:Arfgef2 APN 2 166859782 splice site probably benign
shimmering UTSW 2 166826928 missense probably benign
R0102:Arfgef2 UTSW 2 166845465 missense probably benign 0.00
R0102:Arfgef2 UTSW 2 166845465 missense probably benign 0.00
R0116:Arfgef2 UTSW 2 166873683 missense probably damaging 1.00
R0128:Arfgef2 UTSW 2 166835719 missense probably damaging 1.00
R0130:Arfgef2 UTSW 2 166835719 missense probably damaging 1.00
R0208:Arfgef2 UTSW 2 166867422 missense probably damaging 1.00
R0379:Arfgef2 UTSW 2 166860400 critical splice donor site probably null
R0945:Arfgef2 UTSW 2 166826969 unclassified probably benign
R1226:Arfgef2 UTSW 2 166827640 missense probably damaging 1.00
R1252:Arfgef2 UTSW 2 166859957 missense probably damaging 1.00
R1695:Arfgef2 UTSW 2 166864712 missense probably damaging 0.98
R1696:Arfgef2 UTSW 2 166861638 missense probably damaging 1.00
R1742:Arfgef2 UTSW 2 166866980 missense probably damaging 1.00
R1935:Arfgef2 UTSW 2 166863603 missense probably benign 0.28
R1936:Arfgef2 UTSW 2 166863603 missense probably benign 0.28
R1939:Arfgef2 UTSW 2 166873628 missense probably damaging 1.00
R2276:Arfgef2 UTSW 2 166865759 missense probably benign 0.00
R2279:Arfgef2 UTSW 2 166865759 missense probably benign 0.00
R2349:Arfgef2 UTSW 2 166852028 missense probably damaging 1.00
R2359:Arfgef2 UTSW 2 166860619 missense probably damaging 1.00
R2414:Arfgef2 UTSW 2 166845504 missense probably benign 0.00
R2519:Arfgef2 UTSW 2 166881244 missense probably benign 0.03
R2938:Arfgef2 UTSW 2 166894733 missense probably damaging 1.00
R3696:Arfgef2 UTSW 2 166853300 nonsense probably null
R4022:Arfgef2 UTSW 2 166873945 missense probably benign 0.01
R4227:Arfgef2 UTSW 2 166867324 missense probably damaging 1.00
R4293:Arfgef2 UTSW 2 166890291 missense probably benign
R4455:Arfgef2 UTSW 2 166894715 missense probably benign 0.43
R4570:Arfgef2 UTSW 2 166856538 missense probably damaging 0.99
R4888:Arfgef2 UTSW 2 166835613 missense probably damaging 1.00
R4893:Arfgef2 UTSW 2 166866956 missense probably benign
R5032:Arfgef2 UTSW 2 166878544 missense probably benign
R5191:Arfgef2 UTSW 2 166876511 missense probably damaging 1.00
R5200:Arfgef2 UTSW 2 166860684 missense probably benign 0.00
R5318:Arfgef2 UTSW 2 166873971 missense probably damaging 1.00
R5378:Arfgef2 UTSW 2 166873628 missense probably damaging 1.00
R5537:Arfgef2 UTSW 2 166856593 splice site probably null
R5866:Arfgef2 UTSW 2 166836257 missense possibly damaging 0.88
R5878:Arfgef2 UTSW 2 166870217 missense probably benign 0.41
R5972:Arfgef2 UTSW 2 166891836 missense probably damaging 1.00
R6147:Arfgef2 UTSW 2 166871495 missense probably damaging 1.00
R6293:Arfgef2 UTSW 2 166873588 missense possibly damaging 0.92
R6323:Arfgef2 UTSW 2 166834484 missense probably damaging 1.00
R6338:Arfgef2 UTSW 2 166845570 missense probably damaging 1.00
R6538:Arfgef2 UTSW 2 166893621 splice site probably null
R6726:Arfgef2 UTSW 2 166893620 critical splice donor site probably null
R7047:Arfgef2 UTSW 2 166851945 splice site probably null
R7086:Arfgef2 UTSW 2 166876616 missense probably damaging 1.00
R7108:Arfgef2 UTSW 2 166873608 missense possibly damaging 0.80
R7155:Arfgef2 UTSW 2 166865813 missense probably benign 0.19
R7159:Arfgef2 UTSW 2 166826928 missense probably benign
R7482:Arfgef2 UTSW 2 166851279 critical splice donor site probably null
R7598:Arfgef2 UTSW 2 166856524 missense probably benign
R7869:Arfgef2 UTSW 2 166873703 missense probably damaging 1.00
R7952:Arfgef2 UTSW 2 166873703 missense probably damaging 1.00
R8003:Arfgef2 UTSW 2 166853288 missense not run
X0040:Arfgef2 UTSW 2 166859883 missense probably damaging 1.00
X0063:Arfgef2 UTSW 2 166891841 missense probably benign 0.32
Z1088:Arfgef2 UTSW 2 166893595 missense possibly damaging 0.78
Z1176:Arfgef2 UTSW 2 166894712 missense not run
Predicted Primers PCR Primer
(F):5'- TGCAGTTCAACCCCAATGC -3'
(R):5'- TTGGACTGACCCTTGTGCTG -3'

Sequencing Primer
(F):5'- CTTAGCTCCAGTGCTCAGGATG -3'
(R):5'- ACCCTTGTGCTGGCTCCAG -3'
Posted On2015-07-21