Mutagenetix > Incidental Mutation

Incidental Mutation 'R4499:Agbl3'

331749

Institutional Source

Beutler Lab

Gene Symbol

Agbl3

Ensembl Gene

ENSMUSG00000038836

Gene Name

ATP/GTP binding protein-like 3

Synonyms

4930431N21Rik, 2900053G10Rik, 6530406M24Rik

MMRRC Submission

041752-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4499 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34780432-34859459 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 34857598 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 906 (S906P)

Ref Sequence

ENSEMBL: ENSMUSP00000110668 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115016] [ENSMUST00000115017] [ENSMUST00000148834]

AlphaFold

Q8CDP0

Predicted Effect

probably benign
Transcript: ENSMUST00000115016
AA Change: S906P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836
AA Change: S906P

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	314	563	2.7e-19	PFAM
low complexity region	614	629	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115017
AA Change: S901P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836
AA Change: S901P

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	309	560	1e-33	PFAM
low complexity region	609	624	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000148834

SMART Domains

Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202329

Meta Mutation Damage Score

0.0708

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.9%

Validation Efficiency

92% (47/51)

MGI Phenotype

PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	T	A	13: 77,316,527	W948R	possibly damaging	Het
Ache	A	C	5: 137,291,932	M508L	probably damaging	Het
Adgrb2	A	T	4: 129,992,661	E198V	probably damaging	Het
Adgrl4	A	G	3: 151,510,785	N535S	possibly damaging	Het
Akna	T	C	4: 63,395,041	T282A	probably benign	Het
Arfgef2	G	A	2: 166,885,814	V1561M	probably damaging	Het
Arfgef3	T	C	10: 18,608,343	D1388G	possibly damaging	Het
Asnsd1	A	G	1: 53,347,970	V166A	probably benign	Het
Bank1	T	C	3: 136,284,243	I29V	probably benign	Het
Bpifb5	A	T	2: 154,240,758	I484F	possibly damaging	Het
Camta2	T	C	11: 70,674,686	E788G	probably damaging	Het
Ccdc18	T	G	5: 108,228,960	S1422R	possibly damaging	Het
Cdc42bpg	C	T	19: 6,320,555	P1226L	possibly damaging	Het
Cep126	T	C	9: 8,101,588	N315S	possibly damaging	Het
Dcaf4	T	A	12: 83,539,360	L367Q	probably damaging	Het
Dcc	A	T	18: 71,547,317	V616D	probably benign	Het
Dennd4a	G	A	9: 64,910,123	D1680N	possibly damaging	Het
Dgkq	C	G	5: 108,649,661	E788D	possibly damaging	Het
Dpep2	T	C	8: 105,985,482	E282G	probably benign	Het
Gm14124	T	G	2: 150,269,442	V684G	possibly damaging	Het
Gm8221	T	A	15: 77,626,045		noncoding transcript	Het
Ice1	T	C	13: 70,609,027	S280G	possibly damaging	Het
Lrrc2	A	T	9: 110,962,645	Q155L	probably benign	Het
Mesd	G	A	7: 83,897,977	R216Q	probably benign	Het
Msh6	T	A	17: 87,980,269	N112K	probably damaging	Het
Myo15b	A	G	11: 115,890,952	E307G	probably benign	Het
Nod1	T	A	6: 54,943,996	N446Y	probably damaging	Het
Nrap	G	A	19: 56,351,481	T787I	probably damaging	Het
P2ry12	A	G	3: 59,217,657	I199T	probably damaging	Het
Prr11	T	G	11: 87,098,707	K279N	possibly damaging	Het
Psg25	C	T	7: 18,524,891	E287K	possibly damaging	Het
Rusc1	T	C	3: 89,092,308	S56G	probably benign	Het
Slc16a7	T	C	10: 125,228,187	N427S	probably damaging	Het
Slc47a1	T	A	11: 61,359,529	I341L	probably benign	Het
Slc9a8	T	A	2: 167,424,193	L30Q	probably benign	Het
Ssh2	T	A	11: 77,393,067	L49*	probably null	Het
Stard9	T	A	2: 120,700,241	D2326E	probably benign	Het
Thbs1	T	C	2: 118,119,950	I688T	possibly damaging	Het
Ttn	T	A	2: 76,916,478	E4742D	probably benign	Het
Vps37b	T	C	5: 124,007,626	I117V	probably damaging	Het
Xirp2	A	T	2: 67,513,438	M2008L	probably benign	Het
Zfp53	A	G	17: 21,509,235	E510G	probably damaging	Het
Zswim8	T	A	14: 20,714,297	S578R	probably benign	Het

Other mutations in Agbl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Agbl3	APN	6	34846836	missense	probably damaging	1.00
IGL00835:Agbl3	APN	6	34799732	missense	probably damaging	1.00
IGL00840:Agbl3	APN	6	34799159	missense	possibly damaging	0.95
IGL01090:Agbl3	APN	6	34799887	missense	probably benign	0.40
IGL01123:Agbl3	APN	6	34846976	nonsense	probably null
IGL01707:Agbl3	APN	6	34839454	missense	possibly damaging	0.78
IGL01728:Agbl3	APN	6	34782157	start codon destroyed	probably null
IGL02335:Agbl3	APN	6	34799750	missense	probably damaging	1.00
IGL02420:Agbl3	APN	6	34785307	missense	possibly damaging	0.47
IGL02551:Agbl3	APN	6	34823071	missense	possibly damaging	0.88
IGL02974:Agbl3	APN	6	34799822	missense	probably damaging	1.00
IGL03167:Agbl3	APN	6	34857659	missense	possibly damaging	0.92
IGL03182:Agbl3	APN	6	34803500	missense	probably damaging	1.00
R0044:Agbl3	UTSW	6	34799899	missense	probably damaging	1.00
R0499:Agbl3	UTSW	6	34839335	missense	probably benign
R0639:Agbl3	UTSW	6	34799705	missense	probably damaging	1.00
R0850:Agbl3	UTSW	6	34799204	missense	probably damaging	1.00
R1004:Agbl3	UTSW	6	34803451	missense	probably damaging	0.99
R1080:Agbl3	UTSW	6	34828235	missense	probably benign	0.14
R1589:Agbl3	UTSW	6	34857517	missense	possibly damaging	0.77
R2361:Agbl3	UTSW	6	34832505	missense	possibly damaging	0.87
R2495:Agbl3	UTSW	6	34846764	missense	probably damaging	1.00
R3236:Agbl3	UTSW	6	34823087	splice site	probably null
R3237:Agbl3	UTSW	6	34823087	splice site	probably null
R3420:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3421:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3422:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3810:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R3811:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R4059:Agbl3	UTSW	6	34846899	missense	probably damaging	1.00
R4687:Agbl3	UTSW	6	34798326	missense	probably damaging	1.00
R4854:Agbl3	UTSW	6	34785284	missense	probably damaging	0.97
R5354:Agbl3	UTSW	6	34814752	missense	probably benign	0.03
R5386:Agbl3	UTSW	6	34799196	missense	probably damaging	1.00
R5897:Agbl3	UTSW	6	34803573	missense	probably benign	0.21
R6018:Agbl3	UTSW	6	34799255	missense	probably damaging	1.00
R6148:Agbl3	UTSW	6	34857753	missense	possibly damaging	0.87
R6305:Agbl3	UTSW	6	34782210	missense	unknown
R6525:Agbl3	UTSW	6	34803594	nonsense	probably null
R6546:Agbl3	UTSW	6	34799299	missense	probably damaging	1.00
R6743:Agbl3	UTSW	6	34846953	missense	probably benign	0.03
R6986:Agbl3	UTSW	6	34839452	missense	probably benign	0.42
R7023:Agbl3	UTSW	6	34814769	missense	probably benign	0.02
R7411:Agbl3	UTSW	6	34814819	missense	probably damaging	0.99
R7469:Agbl3	UTSW	6	34814414	missense	probably damaging	1.00
R7631:Agbl3	UTSW	6	34857671	missense	possibly damaging	0.95
R7658:Agbl3	UTSW	6	34832508	missense	probably benign	0.11
R7743:Agbl3	UTSW	6	34846830	missense	probably damaging	1.00
R7801:Agbl3	UTSW	6	34839365	missense	probably benign	0.00
R8033:Agbl3	UTSW	6	34839494	missense	possibly damaging	0.95
R8203:Agbl3	UTSW	6	34799479	missense	probably damaging	1.00
R8769:Agbl3	UTSW	6	34857614	missense	probably damaging	0.96
R9072:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9073:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9210:Agbl3	UTSW	6	34798242	missense	probably damaging	0.98
R9255:Agbl3	UTSW	6	34812905	missense	probably damaging	1.00
R9536:Agbl3	UTSW	6	34846926	missense	probably benign
R9560:Agbl3	UTSW	6	34846908	missense	possibly damaging	0.94
R9662:Agbl3	UTSW	6	34832533	nonsense	probably null
RF014:Agbl3	UTSW	6	34799358	missense	possibly damaging	0.53
Z1177:Agbl3	UTSW	6	34799408	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCGAGGGAAACTTTACAGTCTGC -3'
(R):5'- CTGCAGAACACTGTTACCCCTG -3'

Sequencing Primer
(F):5'- GTCTGCATGATGACAGTATACCTAGG -3'
(R):5'- CCTGATGATACTTGCATCCATGTTAG -3'

Posted On

2015-07-21