Mutagenetix > Incidental Mutations

Incidental Mutation 'R4499:Ice1'

331765

Institutional Source

Beutler Lab

Gene Symbol

Ice1

Ensembl Gene

ENSMUSG00000034525

Gene Name

interactor of little elongation complex ELL subunit 1

Synonyms

BC018507

MMRRC Submission

041752-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.952) question?

Stock #

R4499 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70551707-70637634 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 70609027 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 280 (S280G)

Ref Sequence

ENSEMBL: ENSMUSP00000036482 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043493] [ENSMUST00000222568]

AlphaFold

E9Q286

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043493
AA Change: S280G

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000036482
Gene: ENSMUSG00000034525
AA Change: S280G

Domain	Start	End	E-Value	Type
coiled coil region	22	185	N/A	INTRINSIC
low complexity region	276	292	N/A	INTRINSIC
low complexity region	338	351	N/A	INTRINSIC
low complexity region	372	378	N/A	INTRINSIC
low complexity region	469	481	N/A	INTRINSIC
low complexity region	606	619	N/A	INTRINSIC
low complexity region	769	780	N/A	INTRINSIC
low complexity region	946	958	N/A	INTRINSIC
low complexity region	1061	1073	N/A	INTRINSIC
low complexity region	1329	1352	N/A	INTRINSIC
low complexity region	1595	1604	N/A	INTRINSIC
low complexity region	1656	1671	N/A	INTRINSIC
SCOP:d1gw5a_	2026	2223	5e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000222568

Predicted Effect

probably benign
Transcript: ENSMUST00000222627

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.9%

Validation Efficiency

92% (47/51)

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	T	A	13: 77,316,527	W948R	possibly damaging	Het
Ache	A	C	5: 137,291,932	M508L	probably damaging	Het
Adgrb2	A	T	4: 129,992,661	E198V	probably damaging	Het
Adgrl4	A	G	3: 151,510,785	N535S	possibly damaging	Het
Agbl3	T	C	6: 34,857,598	S906P	probably benign	Het
Akna	T	C	4: 63,395,041	T282A	probably benign	Het
Arfgef2	G	A	2: 166,885,814	V1561M	probably damaging	Het
Arfgef3	T	C	10: 18,608,343	D1388G	possibly damaging	Het
Asnsd1	A	G	1: 53,347,970	V166A	probably benign	Het
Bank1	T	C	3: 136,284,243	I29V	probably benign	Het
Bpifb5	A	T	2: 154,240,758	I484F	possibly damaging	Het
Camta2	T	C	11: 70,674,686	E788G	probably damaging	Het
Ccdc18	T	G	5: 108,228,960	S1422R	possibly damaging	Het
Cdc42bpg	C	T	19: 6,320,555	P1226L	possibly damaging	Het
Cep126	T	C	9: 8,101,588	N315S	possibly damaging	Het
Dcaf4	T	A	12: 83,539,360	L367Q	probably damaging	Het
Dcc	A	T	18: 71,547,317	V616D	probably benign	Het
Dennd4a	G	A	9: 64,910,123	D1680N	possibly damaging	Het
Dgkq	C	G	5: 108,649,661	E788D	possibly damaging	Het
Dpep2	T	C	8: 105,985,482	E282G	probably benign	Het
Gm14124	T	G	2: 150,269,442	V684G	possibly damaging	Het
Gm8221	T	A	15: 77,626,045		noncoding transcript	Het
Lrrc2	A	T	9: 110,962,645	Q155L	probably benign	Het
Mesd	G	A	7: 83,897,977	R216Q	probably benign	Het
Msh6	T	A	17: 87,980,269	N112K	probably damaging	Het
Myo15b	A	G	11: 115,890,952	E307G	probably benign	Het
Nod1	T	A	6: 54,943,996	N446Y	probably damaging	Het
Nrap	G	A	19: 56,351,481	T787I	probably damaging	Het
P2ry12	A	G	3: 59,217,657	I199T	probably damaging	Het
Prr11	T	G	11: 87,098,707	K279N	possibly damaging	Het
Psg25	C	T	7: 18,524,891	E287K	possibly damaging	Het
Rusc1	T	C	3: 89,092,308	S56G	probably benign	Het
Slc16a7	T	C	10: 125,228,187	N427S	probably damaging	Het
Slc47a1	T	A	11: 61,359,529	I341L	probably benign	Het
Slc9a8	T	A	2: 167,424,193	L30Q	probably benign	Het
Ssh2	T	A	11: 77,393,067	L49*	probably null	Het
Stard9	T	A	2: 120,700,241	D2326E	probably benign	Het
Thbs1	T	C	2: 118,119,950	I688T	possibly damaging	Het
Ttn	T	A	2: 76,916,478	E4742D	probably benign	Het
Vps37b	T	C	5: 124,007,626	I117V	probably damaging	Het
Xirp2	A	T	2: 67,513,438	M2008L	probably benign	Het
Zfp53	A	G	17: 21,509,235	E510G	probably damaging	Het
Zswim8	T	A	14: 20,714,297	S578R	probably benign	Het

Other mutations in Ice1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00904:Ice1	APN	13	70602289	missense	probably damaging	1.00
IGL01155:Ice1	APN	13	70604082	missense	possibly damaging	0.93
IGL01298:Ice1	APN	13	70604904	missense	possibly damaging	0.93
IGL01797:Ice1	APN	13	70623946	missense	probably damaging	1.00
IGL02423:Ice1	APN	13	70592599	missense	probably damaging	1.00
IGL02583:Ice1	APN	13	70605735	missense	possibly damaging	0.80
IGL02794:Ice1	APN	13	70609159	missense	possibly damaging	0.95
IGL02882:Ice1	APN	13	70624474	splice site	probably benign
IGL02929:Ice1	APN	13	70596203	missense	probably damaging	1.00
IGL03343:Ice1	APN	13	70602929	missense	probably damaging	1.00
IGL03384:Ice1	APN	13	70603249	missense	probably benign	0.00
PIT4651001:Ice1	UTSW	13	70623921	critical splice donor site	probably null
R0078:Ice1	UTSW	13	70603348	missense	probably damaging	0.98
R0081:Ice1	UTSW	13	70619044	nonsense	probably null
R0281:Ice1	UTSW	13	70604047	missense	possibly damaging	0.64
R0557:Ice1	UTSW	13	70601191	missense	probably benign	0.08
R0973:Ice1	UTSW	13	70602427	missense	probably benign	0.04
R0973:Ice1	UTSW	13	70602427	missense	probably benign	0.04
R0974:Ice1	UTSW	13	70602427	missense	probably benign	0.04
R1033:Ice1	UTSW	13	70606594	missense	probably damaging	0.96
R1371:Ice1	UTSW	13	70596221	missense	probably damaging	1.00
R1525:Ice1	UTSW	13	70605410	missense	probably benign	0.01
R1539:Ice1	UTSW	13	70605904	missense	probably damaging	1.00
R1596:Ice1	UTSW	13	70604895	missense	possibly damaging	0.94
R1603:Ice1	UTSW	13	70603353	missense	probably benign	0.01
R1680:Ice1	UTSW	13	70605448	missense	probably benign	0.00
R1737:Ice1	UTSW	13	70606325	missense	probably damaging	0.99
R1766:Ice1	UTSW	13	70604442	missense	possibly damaging	0.78
R1774:Ice1	UTSW	13	70604553	missense	probably damaging	1.00
R1834:Ice1	UTSW	13	70615338	missense	probably damaging	0.99
R1840:Ice1	UTSW	13	70606218	missense	probably benign	0.00
R1898:Ice1	UTSW	13	70602307	missense	possibly damaging	0.83
R1930:Ice1	UTSW	13	70605083	missense	probably benign	0.18
R2000:Ice1	UTSW	13	70602427	missense	possibly damaging	0.58
R2106:Ice1	UTSW	13	70605622	missense	probably benign	0.00
R2293:Ice1	UTSW	13	70614957	missense	probably damaging	1.00
R2377:Ice1	UTSW	13	70602780	missense	probably damaging	1.00
R2909:Ice1	UTSW	13	70596173	missense	probably damaging	1.00
R2965:Ice1	UTSW	13	70602578	missense	probably benign	0.31
R3730:Ice1	UTSW	13	70603240	missense	probably damaging	1.00
R3886:Ice1	UTSW	13	70605370	missense	probably benign	0.00
R3914:Ice1	UTSW	13	70606084	missense	probably benign	0.30
R4051:Ice1	UTSW	13	70603527	missense	probably damaging	1.00
R4321:Ice1	UTSW	13	70603110	missense	possibly damaging	0.83
R4729:Ice1	UTSW	13	70606384	missense	probably damaging	1.00
R5078:Ice1	UTSW	13	70604850	missense	probably benign
R5431:Ice1	UTSW	13	70592650	missense	probably damaging	1.00
R5722:Ice1	UTSW	13	70615100	missense	possibly damaging	0.95
R5881:Ice1	UTSW	13	70606501	missense	probably benign	0.04
R5914:Ice1	UTSW	13	70606377	missense	possibly damaging	0.93
R6171:Ice1	UTSW	13	70606731	missense	probably benign
R6253:Ice1	UTSW	13	70603164	missense	probably damaging	1.00
R6274:Ice1	UTSW	13	70594839	missense	probably damaging	0.97
R6518:Ice1	UTSW	13	70606309	missense	possibly damaging	0.89
R6665:Ice1	UTSW	13	70603473	missense	possibly damaging	0.85
R6714:Ice1	UTSW	13	70615263	splice site	probably null
R6853:Ice1	UTSW	13	70603302	missense	possibly damaging	0.92
R6917:Ice1	UTSW	13	70594894	missense	probably damaging	1.00
R7032:Ice1	UTSW	13	70596164	missense	probably damaging	0.99
R7176:Ice1	UTSW	13	70624406	critical splice donor site	probably null
R7352:Ice1	UTSW	13	70606102	nonsense	probably null
R7445:Ice1	UTSW	13	70596167	missense
R7646:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7647:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7648:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7650:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7650:Ice1	UTSW	13	70605483	missense	probably damaging	1.00
R7812:Ice1	UTSW	13	70603005	missense	possibly damaging	0.63
R8061:Ice1	UTSW	13	70603732	missense	probably damaging	1.00
R8129:Ice1	UTSW	13	70606201	missense	probably benign	0.02
R8283:Ice1	UTSW	13	70604430	missense	probably damaging	0.97
R8303:Ice1	UTSW	13	70606407	missense	probably benign	0.04
R8444:Ice1	UTSW	13	70604376	missense	probably damaging	1.00
R8474:Ice1	UTSW	13	70604447	missense	probably benign	0.42
R8751:Ice1	UTSW	13	70602891	missense	probably damaging	1.00
R8887:Ice1	UTSW	13	70602931	missense	probably damaging	1.00
R8911:Ice1	UTSW	13	70592668	missense
R8954:Ice1	UTSW	13	70610578	missense	probably damaging	1.00
R9345:Ice1	UTSW	13	70592639	missense
R9438:Ice1	UTSW	13	70606315	missense	probably benign	0.04
X0026:Ice1	UTSW	13	70592602	missense	probably damaging	1.00
Z1176:Ice1	UTSW	13	70605201	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAAGAGCCTGATGCCATCGG -3'
(R):5'- AGCCGTCCACTCATTTCAAG -3'

Sequencing Primer
(F):5'- TGATGCCATCGGAGGGG -3'
(R):5'- GTCCACTCATTTCAAGTTAATTGTGC -3'

Posted On

2015-07-21