Incidental Mutation 'R4499:Zfp53'
ID331768
Institutional Source Beutler Lab
Gene Symbol Zfp53
Ensembl Gene ENSMUSG00000057409
Gene Namezinc finger protein 53
SynonymsZfp-53, KRAZ1, Zfp118, zfas8, D030067O06Rik
MMRRC Submission 041752-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R4499 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location21491256-21509764 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21509235 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 510 (E510G)
Ref Sequence ENSEMBL: ENSMUSP00000075960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076664]
Predicted Effect probably damaging
Transcript: ENSMUST00000076664
AA Change: E510G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000075960
Gene: ENSMUSG00000057409
AA Change: E510G

DomainStartEndE-ValueType
KRAB 54 114 6.06e-23 SMART
ZnF_C2H2 226 248 1.18e-2 SMART
ZnF_C2H2 254 276 1.28e-3 SMART
ZnF_C2H2 282 304 2.65e-5 SMART
ZnF_C2H2 310 332 9.58e-3 SMART
ZnF_C2H2 338 360 2.86e-1 SMART
ZnF_C2H2 366 388 4.24e-4 SMART
ZnF_C2H2 394 416 4.87e-4 SMART
ZnF_C2H2 422 444 3.69e-4 SMART
ZnF_C2H2 450 472 6.23e-2 SMART
ZnF_C2H2 478 500 7.26e-3 SMART
ZnF_C2H2 506 528 1.72e-4 SMART
ZnF_C2H2 534 556 5.14e-3 SMART
ZnF_C2H2 562 584 9.08e-4 SMART
ZnF_C2H2 590 612 3.89e-3 SMART
ZnF_C2H2 618 640 4.87e-4 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 92% (47/51)
MGI Phenotype PHENOTYPE: Homozygous disruption of this locus results in pigmentation abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,316,527 W948R possibly damaging Het
Ache A C 5: 137,291,932 M508L probably damaging Het
Adgrb2 A T 4: 129,992,661 E198V probably damaging Het
Adgrl4 A G 3: 151,510,785 N535S possibly damaging Het
Agbl3 T C 6: 34,857,598 S906P probably benign Het
Akna T C 4: 63,395,041 T282A probably benign Het
Arfgef2 G A 2: 166,885,814 V1561M probably damaging Het
Arfgef3 T C 10: 18,608,343 D1388G possibly damaging Het
Asnsd1 A G 1: 53,347,970 V166A probably benign Het
Bank1 T C 3: 136,284,243 I29V probably benign Het
Bpifb5 A T 2: 154,240,758 I484F possibly damaging Het
Camta2 T C 11: 70,674,686 E788G probably damaging Het
Ccdc18 T G 5: 108,228,960 S1422R possibly damaging Het
Cdc42bpg C T 19: 6,320,555 P1226L possibly damaging Het
Cep126 T C 9: 8,101,588 N315S possibly damaging Het
Dcaf4 T A 12: 83,539,360 L367Q probably damaging Het
Dcc A T 18: 71,547,317 V616D probably benign Het
Dennd4a G A 9: 64,910,123 D1680N possibly damaging Het
Dgkq C G 5: 108,649,661 E788D possibly damaging Het
Dpep2 T C 8: 105,985,482 E282G probably benign Het
Gm14124 T G 2: 150,269,442 V684G possibly damaging Het
Gm8221 T A 15: 77,626,045 noncoding transcript Het
Ice1 T C 13: 70,609,027 S280G possibly damaging Het
Lrrc2 A T 9: 110,962,645 Q155L probably benign Het
Mesd G A 7: 83,897,977 R216Q probably benign Het
Msh6 T A 17: 87,980,269 N112K probably damaging Het
Myo15b A G 11: 115,890,952 E307G probably benign Het
Nod1 T A 6: 54,943,996 N446Y probably damaging Het
Nrap G A 19: 56,351,481 T787I probably damaging Het
P2ry12 A G 3: 59,217,657 I199T probably damaging Het
Prr11 T G 11: 87,098,707 K279N possibly damaging Het
Psg25 C T 7: 18,524,891 E287K possibly damaging Het
Rusc1 T C 3: 89,092,308 S56G probably benign Het
Slc16a7 T C 10: 125,228,187 N427S probably damaging Het
Slc47a1 T A 11: 61,359,529 I341L probably benign Het
Slc9a8 T A 2: 167,424,193 L30Q probably benign Het
Ssh2 T A 11: 77,393,067 L49* probably null Het
Stard9 T A 2: 120,700,241 D2326E probably benign Het
Thbs1 T C 2: 118,119,950 I688T possibly damaging Het
Ttn T A 2: 76,916,478 E4742D probably benign Het
Vps37b T C 5: 124,007,626 I117V probably damaging Het
Xirp2 A T 2: 67,513,438 M2008L probably benign Het
Zswim8 T A 14: 20,714,297 S578R probably benign Het
Other mutations in Zfp53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Zfp53 APN 17 21508338 missense probably benign
IGL00862:Zfp53 APN 17 21509098 missense probably benign 0.04
IGL01651:Zfp53 APN 17 21508086 missense probably benign 0.19
IGL02183:Zfp53 APN 17 21500250 missense possibly damaging 0.51
R0063:Zfp53 UTSW 17 21508105 missense probably benign 0.19
R0449:Zfp53 UTSW 17 21508833 missense probably benign 0.17
R0514:Zfp53 UTSW 17 21509009 missense probably damaging 1.00
R0755:Zfp53 UTSW 17 21508577 missense probably damaging 1.00
R1661:Zfp53 UTSW 17 21509504 missense probably damaging 1.00
R1665:Zfp53 UTSW 17 21509504 missense probably damaging 1.00
R1693:Zfp53 UTSW 17 21509622 missense possibly damaging 0.60
R2113:Zfp53 UTSW 17 21508451 missense probably benign 0.19
R2869:Zfp53 UTSW 17 21508078 missense probably benign 0.00
R2869:Zfp53 UTSW 17 21508078 missense probably benign 0.00
R2870:Zfp53 UTSW 17 21508078 missense probably benign 0.00
R2870:Zfp53 UTSW 17 21508078 missense probably benign 0.00
R2871:Zfp53 UTSW 17 21508078 missense probably benign 0.00
R2871:Zfp53 UTSW 17 21508078 missense probably benign 0.00
R2873:Zfp53 UTSW 17 21508078 missense probably benign 0.00
R2874:Zfp53 UTSW 17 21508078 missense probably benign 0.00
R2908:Zfp53 UTSW 17 21508474 nonsense probably null
R3873:Zfp53 UTSW 17 21508631 missense probably damaging 0.98
R4806:Zfp53 UTSW 17 21505001 missense possibly damaging 0.91
R5007:Zfp53 UTSW 17 21509510 missense probably benign 0.15
R6261:Zfp53 UTSW 17 21508713 missense possibly damaging 0.90
R6329:Zfp53 UTSW 17 21508110 missense probably benign 0.01
R6452:Zfp53 UTSW 17 21509613 missense probably damaging 1.00
R6899:Zfp53 UTSW 17 21508445 missense possibly damaging 0.62
R7033:Zfp53 UTSW 17 21500246 missense probably benign 0.05
R7250:Zfp53 UTSW 17 21509578 missense probably damaging 1.00
R8068:Zfp53 UTSW 17 21509012 missense not run
Predicted Primers PCR Primer
(F):5'- TAGAAGGCATCAGAAAACTCATTCT -3'
(R):5'- TGATGTGTTCTAAGATGTGAGTCC -3'

Sequencing Primer
(F):5'- CTGGTGAAAAGCCTTACAAATGTG -3'
(R):5'- TCTAAGATGTGAGTCCTGGGTAAAG -3'
Posted On2015-07-21