Incidental Mutation 'R4500:4931409K22Rik'
ID331780
Institutional Source Beutler Lab
Gene Symbol 4931409K22Rik
Ensembl Gene ENSMUSG00000038199
Gene NameRIKEN cDNA 4931409K22 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R4500 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location24543432-24556809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24548277 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 459 (D459G)
Ref Sequence ENSEMBL: ENSMUSP00000085642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088302] [ENSMUST00000198887] [ENSMUST00000200634]
Predicted Effect possibly damaging
Transcript: ENSMUST00000088302
AA Change: D459G

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000085642
Gene: ENSMUSG00000038199
AA Change: D459G

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 70 77 N/A INTRINSIC
low complexity region 184 198 N/A INTRINSIC
IQ 205 227 7.58e-2 SMART
coiled coil region 335 382 N/A INTRINSIC
coiled coil region 429 450 N/A INTRINSIC
low complexity region 467 484 N/A INTRINSIC
Pfam:AAA 568 700 1.6e-14 PFAM
low complexity region 819 825 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198709
Predicted Effect probably benign
Transcript: ENSMUST00000198887
SMART Domains Protein: ENSMUSP00000142918
Gene: ENSMUSG00000038199

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 70 77 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199185
Predicted Effect probably benign
Transcript: ENSMUST00000200634
SMART Domains Protein: ENSMUSP00000142624
Gene: ENSMUSG00000038199

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 70 77 N/A INTRINSIC
low complexity region 184 198 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik T A 16: 88,759,541 C214* probably null Het
Ap3s1 T C 18: 46,790,000 V186A possibly damaging Het
Dennd4a G A 9: 64,910,123 D1680N possibly damaging Het
Dpep2 T C 8: 105,985,482 E282G probably benign Het
Fam83d A G 2: 158,785,267 E292G probably benign Het
Gm4981 C T 10: 58,235,706 A229T possibly damaging Het
Hook1 T C 4: 95,993,200 probably null Het
Klhl18 C T 9: 110,429,966 G445S probably damaging Het
Olfr298 A T 7: 86,488,919 C211S probably benign Het
Olfr644 A G 7: 104,068,195 S279P probably damaging Het
Pias3 C T 3: 96,701,418 R259W probably damaging Het
Prr11 T G 11: 87,098,707 K279N possibly damaging Het
Sugp1 T C 8: 70,056,388 S104P probably benign Het
Tmem239 A G 2: 130,407,157 Y145C possibly damaging Het
Uchl4 T C 9: 64,235,881 F215L possibly damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Usp7 C T 16: 8,695,895 E785K possibly damaging Het
Vmn2r66 G A 7: 85,007,954 A81V probably damaging Het
Other mutations in 4931409K22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01383:4931409K22Rik APN 5 24548294 missense probably benign 0.03
IGL02110:4931409K22Rik APN 5 24548084 splice site probably benign
R0329:4931409K22Rik UTSW 5 24545785 unclassified probably null
R0492:4931409K22Rik UTSW 5 24554628 missense probably damaging 1.00
R0585:4931409K22Rik UTSW 5 24550723 missense probably benign
R0656:4931409K22Rik UTSW 5 24549762 missense possibly damaging 0.67
R0894:4931409K22Rik UTSW 5 24550733 unclassified probably null
R1546:4931409K22Rik UTSW 5 24555428 utr 5 prime probably null
R1642:4931409K22Rik UTSW 5 24552688 missense probably damaging 1.00
R1998:4931409K22Rik UTSW 5 24545006 missense probably benign 0.01
R2090:4931409K22Rik UTSW 5 24550676 missense probably benign 0.15
R2186:4931409K22Rik UTSW 5 24554526 missense probably damaging 1.00
R2237:4931409K22Rik UTSW 5 24548294 missense probably benign 0.03
R2256:4931409K22Rik UTSW 5 24552040 utr 3 prime probably benign
R2257:4931409K22Rik UTSW 5 24552040 utr 3 prime probably benign
R3078:4931409K22Rik UTSW 5 24546666 missense probably benign
R3522:4931409K22Rik UTSW 5 24549626 critical splice donor site probably null
R3910:4931409K22Rik UTSW 5 24545442 splice site probably benign
R3911:4931409K22Rik UTSW 5 24545442 splice site probably benign
R4333:4931409K22Rik UTSW 5 24544370 missense probably damaging 1.00
R4335:4931409K22Rik UTSW 5 24544370 missense probably damaging 1.00
R4761:4931409K22Rik UTSW 5 24551983 missense probably benign
R4773:4931409K22Rik UTSW 5 24550598 critical splice donor site probably null
R4880:4931409K22Rik UTSW 5 24549752 missense probably benign
R5614:4931409K22Rik UTSW 5 24550142 missense probably benign 0.03
R5839:4931409K22Rik UTSW 5 24552026 missense probably damaging 0.98
R5847:4931409K22Rik UTSW 5 24544166 missense probably benign 0.16
R7061:4931409K22Rik UTSW 5 24545065 missense probably benign 0.00
R7131:4931409K22Rik UTSW 5 24548956 missense possibly damaging 0.81
R7156:4931409K22Rik UTSW 5 24552650 missense probably benign 0.05
R7248:4931409K22Rik UTSW 5 24544271 missense probably benign 0.00
R7480:4931409K22Rik UTSW 5 24546906 missense probably damaging 1.00
R7693:4931409K22Rik UTSW 5 24546628 missense probably benign 0.01
R7782:4931409K22Rik UTSW 5 24544226 missense probably damaging 0.98
R7814:4931409K22Rik UTSW 5 24545422 missense possibly damaging 0.95
R7898:4931409K22Rik UTSW 5 24553645 missense probably damaging 1.00
R7981:4931409K22Rik UTSW 5 24553645 missense probably damaging 1.00
R8024:4931409K22Rik UTSW 5 24550636 missense possibly damaging 0.70
X0063:4931409K22Rik UTSW 5 24549765 splice site probably null
Z1177:4931409K22Rik UTSW 5 24550795 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTCCACTCGCAGTGTAAGG -3'
(R):5'- TCAGTGGAGCAAAGACTGAC -3'

Sequencing Primer
(F):5'- TGTGCGGCAGAATCTACTAC -3'
(R):5'- AGACTGACACGTGACTCGGTG -3'
Posted On2015-07-21